Skip to main content

Advertisement

Table 1 Host gene and CSFV RNA analyzed and primer sets for real-time RT-PCR

From: Classical swine fever virus induces oxidative stress in swine umbilical vein endothelial cells

Genes Forward primer Reverse primer Product length (bp)
Trx 5′- CAAAGTATTCCAATGTCGTGTTCC-3′ 5′ - AGTTCACCCACCTTCTGTCCC -3′ 127
PRDX-6 5′ -GTGAGGAGCCCAAGGAAACG-3′ 5′ - CCCAACTGGATGGCAAGGTC-3′ 73
HO-1 5′-GTCCTCAAGAAGATTGCTCAGAAG-3′ 5′-GTCATCTCCAGAGTGTTCATTCG-3′ 140
COX-2 5′ -CTTCCTCCTGTGCCTGATGACTG-3′ 5′-GGTCCTCGCTTCTGATCTGTCTTG-3′ 200
PPAR-γ 5′-TGACAGGAAAGACCACAGACAAAT-3′ 5′-GGGTGATGTGTTTGAACTTGATT-3′ 96
CSFV 5′- TCAACCGAAGAAATGGGAGATG-3′ 5′ - TCCACCCTATTGGGCAGACA-3′ 133
β-actin 5′ -CGTCCACCGCAAATGCTTC-3′ 5′ -AACCGACTGCTGTCACCTTCAC-3′ 217