Skip to main content

Table 2 Primer sequences for identification and detection of the virulence associated genes in P. multocida strains

From: Alternative treatment of serious and mild Pasteurella multocida infection in New Zealand White rabbits

Gene Primer sequence Accession number Reference
kmt1 F - ATCCGCTATTTACCCAGTGG [GenBank:NC_017027] [21]
R - GCTGTAAACGAACTCGCCAC   
hyaC-hyaD F - TGCCAAAATCGCAGTCAG [GenBank:NZ_CM002276] [22]
R - TTGCCATCATTGTCAGTG   
pfhA F - AGCTGATCAAGTGGTGAAC [GenBank:NC_016808] This study
R - TGGTACATTGGTGAATGCTG   
nanH F - GAATATTTGGGCGGCAACA [GenBank:NC_017764] [23]
R - TTCTCGCCCTGTCATCACT   
hgbA F - TGGCGGATAGTCATCAAG [GenBank:NZ_CM002276] [23]
R - CCAAAGAACCACTACCCA   
ompH F - CGCGTATGAAGGTTTAGGT [GenBank:NZ_CM001580] [23]
R - TTTAGATTGTGCGTAGTCAAC   
ptfA F - TCCACTCGTTGTGGCATTCA [GenBank:NC_017027] This study
R - AGAAACACCTTGAGCTGCGT