Skip to main content

Table 2 Sequences of primers and probes used during the study

From: Novel locked nucleic acid (LNA)-based probe for the rapid identification of Chlamydia suisusing real-time PCR

  Sequence (5′-3′) Source
CS1F AATCGAAGAGATTCCCTGTGT This study
CS1R CCACCTTTCCAGATGTGTTC This study
CS1PR FAM– T [+G] A [+A] [+G] A [+A] GC [+G] [+A] G –BHQ1 This study
TQF GAAAAGAACCCTTGTTAAGGGAG Everett et al. [15]
TQR CTTAACTCCCTGGCTCATCATG Everett et al. [15]
Probe FAM-CAAAAGGCACGCCGTCAAC-TAMRA Everett et al. [15]
  1. [+N] – LNA BASES.