Skip to main content

Table 4 Primers and probes used in cloning, CDV RT-iiPCR and real-time RT-PCR

From: Rapid and sensitive detection of canine distemper virus by one-tube reverse transcription-insulated isothermal polymerase chain reaction

Primer Nucleotide sequence (5'-3') Note*
CDV-F AGCTAGTTTCATCTTAACTATCAAATT CDV real-time RT-PCR forward primera
CDV-R TTAACTCTCCAGAAAACTCATGC CDV real-time RT-PCR reverse primera
CDV-P FAM-ACCCAAGAGCCGGATACATAGTTTCAATGC-BHQ1 CDV real-time RT-PCR probea
CDV-F1 ATGGCTAGCCTTCTTAAAAGCCTCACA CDV cloning primer (nt108-134)*
CDV-R1 TTCCGATCATCGTCATTTCCATCA CDV cloning primer (nt1570-1547)*
CDViiF CCGGAAATCAACGGACCTAAATT CDV RT-iiPCR primer (nt291 ~ 313)*
CDViiR GTCGTCTATGATCCTCTGGATCAA CDV RT-iiPCR primer (nt389 ~ 366)*
CDViiP FAM-CAGTATCCTCTCCTTGTTCGTGGA-MGB-NFQ CDV RT-iiPCR probe (nt329 ~ 352)*
  1. *Nucleotide position is based on GenBank accession no. AF305419.1; aElia et al. [42].