Skip to main content

Table 2 Primer sequences used for qualitative and quantitative (q) real time RT-PCR, and RACE and the expected product size

From: Cloning and tissue distribution of novel splice variants of the ovine ghrelin gene

Primer name Assay Sequence (5′-3′) Exon position Target gene Amplicon sizes (bp)
GHRL-1 F RT-PCR TTTCTGAGCCCTGAACATCAG 1 GHRL 305 canonical (wild-type) preproghrelin
GHRL-4R   GAGAACAGACAGGTGGTTGG 4   
GHRL-5OF RACE ATGAATGAACACTGCGTTTGCT N/A GHRL 174
GHRL-5OR   CAGTTTCTGATGTTCAGGGCTC 1
GHRL-5IF RACE GAACACTGCGTTTGCTGGCT N/A GHRL 130
GHRL-5IR   GGCCAAGTCCATCCAGAGCA 1
GHRL-2F qRT-PCR CTAAGAAGCCGTCAGGCAGACT 2 GHRL (preproghrelin) 153
GHRL-2R   GGGACTGAGCCCCTGACA 3
GHRL1_3F qRT-PCR CAGAAACTGCAGTTCAATGC 1 / 3 GHRL (Δex2 preproghrelin) 224
GHRL-4R   CACGTGGTCTCGGAAGTGT 4
GHRL1_4F qRT-PCR CTGCAGAAACCCTGGCTGA 1 / 4 GHRL (Δex2,3 preproghrelin) 109
GHRL-4R   CACGTGGTCTCGGAAGTGT 4
GOAT-mF qRT-PCR GGTTTCAAGCTCGAGTTGAAGG N/A MBOAT4 (GOAT) 212
GOAT-mR   AGTAGGTGAGTTTGAAGAGCCC
GAPDH-F qRT-PCR CCTGGAGAAACCTGCCAAGT N/A GAPDH 209
GAPDH-R   GCCAAATTCATTGTCGTACCA