Skip to main content

Advertisement

Table 5 Characteristics of primers used for qPCR analysis

From: Effects of dietary polyphenol-rich plant products from grape or hop on pro-inflammatory gene expression in the intestine, nutrient digestibility and faecal microbiota of weaned pigs

Gene1 Forward primer (from 5'to 3')Reverse primer (from 5'to 3') PCR product size (bp) NCBI GenBank
Reference genes
ATP5G1 CAGTCACCTTGAGCCGGGCGA 94 NM_001025218.2
TAGCGCCCCGGTGGTTTGC
ACTB GACATCCGCAAGGACCTCTA 205 XM_003124280.3
ACATCTGCTGGAAGGTGGAC
GAPDH AGGGGCTCTCCAGAACATCATCC 446 NM_001206359.1
TCGCGTGCTCTTGCTGGGGTTGG
GPI CACGAGCACCGCTCTGACCT 365 NM_214330.1
CCACTCCGGACACGCTTGCA
RPS9 GTCGCAAGACTTATGTGACC 327 XM_005664825.1
AGCTTAAAGACCTGGGTCTG
SDHA CTACGCCCCCGTCGCAAAGG 380 DQ402993
AGTTTGCCCCCAGGCGGTTG
NF-κB and nutrient transporter target genes
CCL2 GGTCCTTGCCCAGCCAGATGC 170 NM_214214.1
CTGCACAGATCTCCTTGCCCGC
ICAM1 CGGTGGCAGCCGTGGCTATC 208 NM_213816.1
TTGATGCAGCCCCGCTCGTC
IL1B GTTCTCTGAGAAATGGGAGC 143 NM_214055.1
CTGGTCATCATCACAGAAGG
IL8 ACTTCCAAACTGGCTGTTGC 120 NM_213867.1
GGAATGCGTATTTATGCACTGG
SLC2A2 GCTGGATGGGGAAGCCAAAGCA 355 NM_001097417.1
AGAGCGTCGCCCTGCCTTCT
SLC2A5 CTGACACTGGTGCTTGCTTT 156 EU012359.2
TTCGCTCATGTATTCCCCGA
SLC5A1 GTGGCGGACAGTAGTGAACA 89 NM_001164021.1
AGAAGGCAGGATTTCAGGCA
SLC15A1 CAGACTTCGACCACAACGGA 99 NM_214347.1
TTATCCCGCCAGTACCCAGA
TNF CATGAGCACTGAGAGCATGA 170 NM_214022.1
CGATAACTTCGAAGTGCAGT
Bacterial group
Bifidobacterium spp. TCGCGTC(A/T)GGTGTGAAAG 243  
CCACATCCAGC(A/G)TCCAC
Clostridium Cluster XIVa AAATGACGGTACCTGACTAA 485  
CTTTGAGTTTCATTCTTGCGAA
Lactobacillus spp. AGCAGTAGGGAATCTTCCA 341  
CACCGCTACACATGGAG
Streptococcus spp. AGAGTTTGATCCTCCGTCAG 144  
GTTAGCCGTCCCTTTCTGG
  1. 1ATP5G1 = ATP synthase lipid-binding protein; ACTB = actin beta; GAPDH = glyceraldehyde 3-phosphate dehydrogenase; GPI = glucose-6-phosphate isomerase; RPS9 = ribosomal protein; SDHA = succinate dehydrogenase complex, subunit A; CCL2 = chemokine (C-C motif) ligand 2; SLC2A2 = solute carrier family 2 (facilitated glucose transporter) 2; SLC2A5 = solute carrier family 2 (facilitated glucose transporter) 5; SLC5A1 = sodium-glucose transporter 1; SLC15A1 = solute carrier family 15 (oligopeptide transporter), member 1; ICAM1 = intercellular adhesion molecule; IL = interleukin; TNF = tumor necrosis factor.