Skip to main content

Table 5 Characteristics of primers used for qPCR analysis

From: Effects of dietary polyphenol-rich plant products from grape or hop on pro-inflammatory gene expression in the intestine, nutrient digestibility and faecal microbiota of weaned pigs

Gene1 Forward primer (from 5'to 3')Reverse primer (from 5'to 3') PCR product size (bp) NCBI GenBank
Reference genes
NF-κB and nutrient transporter target genes
Bacterial group
Bifidobacterium spp. TCGCGTC(A/T)GGTGTGAAAG 243  
Clostridium Cluster XIVa AAATGACGGTACCTGACTAA 485  
Lactobacillus spp. AGCAGTAGGGAATCTTCCA 341  
Streptococcus spp. AGAGTTTGATCCTCCGTCAG 144  
  1. 1ATP5G1 = ATP synthase lipid-binding protein; ACTB = actin beta; GAPDH = glyceraldehyde 3-phosphate dehydrogenase; GPI = glucose-6-phosphate isomerase; RPS9 = ribosomal protein; SDHA = succinate dehydrogenase complex, subunit A; CCL2 = chemokine (C-C motif) ligand 2; SLC2A2 = solute carrier family 2 (facilitated glucose transporter) 2; SLC2A5 = solute carrier family 2 (facilitated glucose transporter) 5; SLC5A1 = sodium-glucose transporter 1; SLC15A1 = solute carrier family 15 (oligopeptide transporter), member 1; ICAM1 = intercellular adhesion molecule; IL = interleukin; TNF = tumor necrosis factor.