Skip to main content

Table 9 Allele-specific primers and positive control used for genotyping

From: Assessment of Toll-like receptor 2, 4 and 9 SNP genotypes in canine sino-nasal aspergillosis

SNP Primer Primer sequence (5′-3′) Positive control
TLR2   
C137A Forward CCGCTCCAGATCTTTGAAgTC CCGCTCCAGATCTTTGAACTCCATGCATTGGCAACAGTGACCTTCGGGATT
(110 bp) [60°C] CCGCTCCAGATCTTTGAAgTA CCGCTCCAGATCTTTGAACTACATGCATTGGCAACAGTGACCTTCGGGATT
Reverse AATCCCGAAGGTCACTGTTG  
C1547T Forward GCCTCCTTCTTACCCACCTT  
(81 bp) [60°C] Reverse GGAATCCAGTTGCTCCTaCG GGAATCCAGTTGCTCCTTCGAGAAAGAATTTGTAAGGTGGGTAAGAAGGAGGC
GGAATCCAGTTGCTCCTaCA GGAATCCAGTTGCTCCTTCAAGAAAGAATTTGTAAGGTGGGTAAGAAGGAGGC
TLR4   
C107T Forward GGAAAGGAGAGAGGGCAGTT  
(101 bp) [60°C] Reverse AGCTCCATGCATTGGTAAGaAG AGCTCCATGCATTGGTAAGTAGGCATGCACCTCAACTGCCCTCTCTCCTTTCC
AGCTCCATGCATTGGTAAGaAA AGCTCCATGCATTGGTAAGTAAGCATGCACCTCAACTGCCCTCTCTCCTTTCC
T500C Forward CAATCTTATCCATTCCTTCAAcCT CAATCTTATCCATTCCTTCAAGCTTGCGTATTTCTCTAACATGCCCAACCTGGAG
(58 bp) [60°C] CAATCTTATCCATTCCTTCAAcCC CAATCTTATCCATTCCTTCAAGCCTGCGTATTTCTCTAACATGCCCAACCTGGAG
Reverse CTCCAGGTTGGGCATGTTAG  
A600C Forward CTAACATGCCCAACCTGGAG  
(110 bp) [60°C] Reverse TAAAGAAAGGTTGAGTAGTGGCtTT TAAAGAAAGGTTGAGTAGTGGCATTTGATGTAGACGTTCTCCAGGTTGGGCATGTTAG
TAAAGAAAGGTTGAGTAGTGGCtTG TAAAGAAAGGTTGAGTAGTGGCATGTGATGTAGACGTTCTCCAGGTTGGGCATGTTAG
A688G Forward GGTTCCTTTAAAGAAATTAAACTCgATA GGTTCCTTTAAAGAAATTAAACTCCATAAACTGACTTTGAGAAGCCAGCCAGACCTTGAATA
(97 bp) [60°C] GGTTCCTTTAAAGAAATTAAACTCgATG GGTTCCTTTAAAGAAATTAAACTCCATGAACTGACTTTGAGAAGCCAGCCAGACCTTGAATA
Reverse AGCCAGCCAGACCTTGAATA  
G1039A Forward ATGGCAACGGTTGGAAATAG  
(66 bp) [60°C] Reverse AGAGAGTCCAGCTCCCAaGC AGAGAGTCCAGCTCCCATGCCTAAGTTACAATTAACTATTTCCAACCGTTGCCAT
AGAGAGTCCAGCTCCCAaGT AGAGAGTCCAGCTCCCATGTCTAAGTTACAATTAACTATTTCCAACCGTTGCCAT
A1571T Forward ATGGCTGATAATTCCTTTCC  
(163 bp) [55°C] Reverse GGCTATTGTGACTCATATTTAaCA GGCTATTGTGACTCATATTTATCAAGGGAGTTGTCCGGAAAGGAATTATCAGCCAT
GGCTATTGTGACTCATATTTtTCT GGCTATTGTGACTCATATTTATCTAGGGAGTTGTCCGGAAAGGAATTATCAGCCAT
G1807A Forward TGGGTCAAAGACCACAGACA  
(53 bp) [60°C] Reverse GCACACACCATTTGTTCAAgTTC GCACACACCATTTGTTCAACTTCCACCAAGAGCTGTCTGTGGTCTTTGACCCA
GCACACACCATTTGTTCAAgTTT GCACACACCATTTGTTCAACTTTCACCAAGAGCTGTCTGTGGTCTTTGACCCA
TLR9   
G1138A Forward GCGCAGACTCAACCTGTCCTT  
(152 bp) [55°C] Reverse GCGACTGGAGCGTGGTgTC GCGACTGGAGCGTGGTCTCCTTATGATAATTGAAGGACAGGTTGAGTCTGCGC
GCGACTGGAGCGTGGTgTT GCGACTGGAGCGTGGTCTTCTTATGATAATTGAAGGACAGGTTGAGTCTGCGC
A1372C Forward GCGGCTGCCACAGGGGAGGT  
(95 bp) [60°C] Reverse GAGCCGGGGGTGCCCAGaGT GAGCCGGGGGTGCCCAGTGTCACAGTCTGCCTCTACCTCCCCTGTGGCAGCCGC
AGCCGGGGGTGCCCAGaGG GAGCCGGGGGTGCCCAGTGGCACAGTCTGCCTCTACCTCCCCTGTGGCAGCCGC
A2158G Forward CTGGACCTCAGCGGCAACAG  
(58 bp) [60°C] Reverse CGGCCAGGGCAAAAAAcCT CGGCCAGGGCAAAAAAGCTCACGAAGCCGATGCTGTTGCCGCTGAGGTCCAG
CGGCCAGGGCAAAAAAcCC CGGCCAGGGCAAAAAAGCCCACGAAGCCGATGCTGTTGCCGCTGAGGTCCAG
G2927A Forward CTCCTGCGTGCCAGCTTCCT  
(113 bp) [55°C] Reverse AGCCGCACATAGCGGGtGC AGCCGCACATAGCGGGAGCCTGTTGGGCCAGCAGGAAGCTGGCACGCAGGAG
AGCCGCACATAGCGGGtGT AGCCGCACATAGCGGGAGTCTGTTGGGCCAGCAGGAAGCTGGCACGCAGGAG
  1. The polymorphic base is in bold, the additional inserted 3′ mismatch is in lowercase, the amplicon size in base pairs (bp) and annealing temperature [°C] used for the qPCT are shown below the SNP name.