Skip to main content

Table 8 Additional internal sequencing primers used

From: Assessment of Toll-like receptor 2, 4 and 9 SNP genotypes in canine sino-nasal aspergillosis

Gene Primer set Primer sequence (5′-3′)
TLR2 TLR2 sequencing forward TGGTTCCTTGCTCACTTTCA
  TLR2 sequencing reverse TGGCAAAATCAGGGAAAATG
TLR4 TLR4 exon 3 sequencing forward GGTGTCCCAGGAATCATTTG
  TLR4 exon 3 sequencing reverse TAGGATCTGGAGGGAGAGGAG
TLR9 TLR9 exon 3 sequencing forward GTTCAGCCGGAGATGTTTGT
  TLR9 exon 3 sequencing reverse CCAGCTTGTTATGGGACAGG