From: Assessment of Toll-like receptor 2, 4 and 9 SNP genotypes in canine sino-nasal aspergillosis
Gene | Primer set | Primer sequence (5′-3′) |
---|---|---|
TLR2 | TLR2 sequencing forward | TGGTTCCTTGCTCACTTTCA |
TLR2 sequencing reverse | TGGCAAAATCAGGGAAAATG | |
TLR4 | TLR4 exon 3 sequencing forward | GGTGTCCCAGGAATCATTTG |
TLR4 exon 3 sequencing reverse | TAGGATCTGGAGGGAGAGGAG | |
TLR9 | TLR9 exon 3 sequencing forward | GTTCAGCCGGAGATGTTTGT |
TLR9 exon 3 sequencing reverse | CCAGCTTGTTATGGGACAGG |