Skip to main content

Table 2 Primers used in this study

From: Oral immunization with an attenuated Salmonella Gallinarum mutant as a fowl typhoid vaccine with a live adjuvant strain secreting the B subunit of Escherichia coliheat-labile enterotoxin

Primer Primer sequence (5’- 3’) Source
OMPC-F ATCGCTGACTTATGCAATCG Alvarez et al. (2004)
OMPC-R CGGGTTGCGTTATAGGTCTG  
SG-F GATCTGCTGCCAGCTCAA Kang et al. (2011)
SG-R GCGCCCTTTTCAAAACATA  
lon-both-F ATTTTATCTCCCCTTTCGTTTTTC Jeon et al. (2012)
lon-both-R CTGCCAGCCCTGTTTTTATTAGC  
cpxR-both-F CAGCGCCAGCGTCAACCAGAAGAT Jeon et al. (2012)
cpxR-both-R GAGGCCATAACAGCAGCGGTAACT  
LTB-F GCTCCCCAGTCTATTACAG Hur and Lee (2011)
LTB-R CTAGTTTTCCATACTGATTG