Skip to main content

Table 2 Oligonucleotide primers designed for LAMP assays targeting the P32, RNA polymerase subunit RPO30 and DNA topoisomerase I

From: Detection of capripoxvirus DNA using a novel loop-mediated isothermal amplification assay

Target Region Primer Length Position Sequence (5′ – 3′)
P32 FIP 58 F1c 610-639 TTCAAAACTCAAACTGGTAGAAATACCTTT-
    F2 559-582 -GTAATTAGATTATCGTCTGCCATA
  BIP 56 B1c 667-696 CTCAATAGACAAGTTTTAAATGACTCATCT-
    B2 724-745 -CGTTAGCTCTTTTTTTTGACAA
  F3 24 532-555 GGATATGATTTTACCTTATCTGCA
  B3 23 754-776 CCAACTCTATTCCATATACCGTT
  FLoop 13 590-602 ATAATTTCGTTTA
  BLoop 15 706-720 CTTCACAATACTAAG
RNA Polymerase FIP 59 F1c 300-331 CTGTTCCATTTGTAGTACGTATAAGATTACAT-
Subunit RPO30    F2 244-266 -ATTATCGTATAGAAACAAGCCTT
  BIP 55 B1c 437-468 ATGTTTTAGATAAAAAGTATAACCTCCCATGC-
    B2 487-505 -TCATGACGGGAATAGTGTT
  F3 21 195-215 TGAACCAAGAAACAACATAGG
  B3 18 507-524 TCTGCTGCTCTTGTTTGT
DNA FIP 54 F1c 95-117 GTGGGGCGGTATTCTAATCTTTT-
Topoisomerase I    F2 56-81 -CTCTTGTATCATTTGATAATCCTACT
  BIP 52 B1c 135-159 TTACGAACAAACGTATGAACAGTCA-
    B2 178-199 -TACCTTTCGAATCTGAACCAAC
  F3 23 21-43 CGATGGAAAACTTTTTACGGATA
  B3 24 203-226 GCAGTTTTCCATAAAAATATTGCC