Skip to main content

Table 1 Primer sequences

From: Glucocorticoid receptor is involved in the breed-dependent transcriptional regulation of mtDNA- and nuclear-encoded mitochondria genes in the liver of newborn piglets

Primer name Sequence Source sequence Tm (°C) Used for
COX1 F: TGGTGCCTGAGCAGGAATAGTG ENSSSCG00000018075 64 mRNA quantification
  R: ATCATCGCCAAGTAGGGTTCCG    
COX2 F: GCTTCCAAGACGCCACTTCAC ENSSSCG00000018078 64 mRNA quantification
  R: TGGGCATCCATTGTGCTAGTGT    
COX3 F: GGCTACAGGGTTTCACGGGTTG ENSSSCG00000018082 64 mRNA quantification
  R: TCAGTATCAGGCTGCGGCTTCA    
ND3 F: AGCACGCCTCCCATTCTCAAT ENSSSCG00000018084 64 mRNA quantification
  R: TGCTAGGCTTGCTGCTAGTAGG    
CYTB F: CTGAGGAGCTACGGTCATCACA ENSSSCG00000018094 64 mRNA quantification
  R: GCTGCGAGGGCGGTAATGAT    
ND1 F: TCCTACTGGCCGTAGCATTCCT ENSSSCG00000018065 64 mRNA quantification
  R: TTGAGGATGTGGCTGGTCGTAG    
ND2 F: ATCGGAGGGTGAGGAGGGCTAA ENSSSCG00000018069 64 mRNA quantification
  R: GTTGTGGTTGCTGAGCTGTGGA    
ND4L F: GATCGCCCTTGCAGGGTTACTT ENSSSCG00000018086 64 mRNA quantification
  R: CTAGTGCAGCTTCGCAGGCT    
ND4 F: TCGCCTATTCATCAGTAAGTCA ENSSSCG00000018087 64 mRNA quantification
  R: GGATTATGGTTCGGCTGTGTA    
ND5 F: CGGATGAGAAGGCGTAGGAA ENSSSCG00000018091 64 mRNA quantification
  R: GCGGTTGTATAGGATTGCTTGT    
ND6 F: ACTGCTATGGCTACTGAGATGT ENSSSCG00000018092 64 mRNA quantification
  R: CTTCCTCTTCCTTCAACGCATA    
ATP6 F: ACTCATTCACACCCACCACACA ENSSSCG00000018081 64 mRNA quantification
  R: CCTGCTGTAATGTTGGCTGTCA    
ATP8 F: TGCCACAACTAGATACATCC ENSSSCG00000018080 62 mRNA quantification
  R: GCTTGCTGGGTATGAGTAG    
IDH2 F: GGACAGTCACCCGCCACTA ENSSSCG00000001852 62 mRNA quantification
  R: CGTCCAGGCAAAGATGCTG    
AK1 F: TTGGACATGCTCCGAGACGC ENSSSCG00000005627 62 mRNA quantification
  R: CCGATCTTCCGCTCAAACTCTT    
ATP5H F: CTACCTGAGAAGCCACCTGC NM_001244684 62 mRNA quantification
  R: GCTGCCCACCTATGACCAC    
PPIA F: GACTGAGTGGTTGGATGG ENSSSCG00000016737 62 mRNA quantification
  R: TGATCTTCTTGCTGGTCTT    
18S F: CCCACGGAATCGAGAAAGAG ENSSSCG00000001502 64 DNA contamination detection
  R: TTGACGGAAGGGCACCA    
MT_controlregion F: CCCTATAACGCCTTGCCAAACC   62 ChIP, MeDIP, mtDNA copy number
  R: GGGTAGGTGCCTGCTTTCGTAG    
MT_GRE_neg F: TCGCCTATTCATCAGTAAGT   62 ChIP
  R: GAGGATGTTAGTCCGTGGG    
MT_MeDIP_neg F: CTCAGTAGCCATAGCAGTA   62 MeDIP
  R: TGGACTTGGGTTGATTGT    
IDH2_promoter F: GGTTCAACAAGCCTTACTCACA   62 ChIP, MeDIP
  R: GGAGACAGGAGCCGCATAG    
AK1_promoter F: TGGGAGATGGATATGTGGGC   62 ChIP, MeDIP
  R: GCATGGATTCTGGGGACTGT    
ATP5H_promoter F: CCAAAGGTACATGGACTGC   62 ChIP, MeDIP
  R: GCATCTTGGGTGGTTTTAT    
PPIA_GRE_neg F: GTTCACAGGGTGGTGACTT   62 ChIP
  R: CAGGACCCGTATGCTTCA    
ACTB_MeDIP_neg F: CTGGGCATCAGAACCTGT   62 MeDIP, mtDNA copy number
  R: GAGCAATCCCCTGAAGAA