Skip to main content

Table 1 Primers used for real-time qPCR

From: Gene expression profiles in canine mammary carcinomas of various grades of malignancy

Gene symbol Forward primer Reverse primer Optimum annealing temp. (°C) Optimum annealing time (sec)
eif4b CTTTCTGGCTGAGGATGGAG GGGCAGGTTCCCTAGAAAAG 59 10
atf6 GTCTCCAGCCTCCTCAAGTG GGCTCTGCTAAGGAGGGACT 64 6
tmem 85 AATGGGACTGCTGCCTACAC TCTGGGATTGGTCTCCTCAC 62 6
hprt AGCTTGCTGGTGAAAAGGAC TTATAGTCAAGGGCATATCC 59 6
rps19 CCTTCCTCAAAAAGTCTGGG GTTCTCATCGTAGGGAGCAAG 61 10
  1. Primers sequences used in this study and their annealing optimal temperature and time. The mRNA sequences of key genes were obtained from NCBI database. Primers were designed using PRIMER3 software (free online access) and checked using Oligo Calculator (free on-line access) and Primer-Blast (NCBI database). Primers sequences are listed in Table 1. Hprt and rps19 genes were used as non-regulated reference genes for normalization of target gene expression [6, 7].