Skip to main content

Table 3 Primers used in this study

From: Biochemical and molecular heterogeneity among isolates of Yersinia ruckeri from rainbow trout (Oncorhynchus mykiss, Walbaum) in north west Germany

PCR Name Sequence (5′ → 3′) References
Specific PCR of Y. ruckeri YER8 GCGAGGAGGAAGGGTTAAGTG [45]
YER10 GAAGGCACCAAGGCATCTCTG [45]
(GTG)5-PCR (GTG)5 GTGGTGGTGGTGGTG [44]
BOX-PCR BOXA1R CTACGGCAAGGCGACGCTGACG [44]
ERIC-PCR ERIC2 AAGTAAGTGACTGGGGTGAGCG [44]
ERIC1R ATGTAAGCTCCTGGGGATTCAC [44]
REP-PCR REP2-I ICGICTTATCIGGCCTAC [44]
REP1R-I IIIICGICGICATCIGGC [44]