Skip to main content

Table 2 Sequences and kind of primers used for polymerase chain reaction

From: Change in mRNA expression of sirtuin 1 and sirtuin 3 in cats fed on high fat diet

Primer Kind Sequence (5′-3′) Applications Position
SIRT1     
1 Sense GAGAGGCAGTTGGAAGATGG RT-PCR 47
2 Antisense CTGTTGCTTCCTGTTTCACG RT-PCR 2275
3 Sense CAACGGTTTGGAAGACGATGCTG 3′ RACE 2156
4 Antisense TCTTCCTCCTCTTCGCCCTCGTCGT 5′ RACE 452
5 Sense CGCCTTGCAATAGACTTCCC q-PCR 897
6 Antisense TGAATTTGTGACAGAGAGATGGTTG q-PCR 1042
SIRT3     
7 Sense AGGACCTAGCTGAGCTGATTCG RT-PCR 349
8 Antisense TGTGTGTAGAGCCGCAGAAG RT-PCR 656
9 Sense CTATTTCCTCCGCCTGCTCCACGAC 3′ RACE 603
10 Antisense AGGCCGCTCCTTGGAGACCTGAAGT 5′ RACE 464
11 Sense TGCTTCTGCGGCTCTACAC q-PCR 635
12 Antisense TGTCTCCCCAAAGAACACGA q-PCR 864
Beta-actin   
13 Sense GCCAACCGTGAGAAGATGACT q-PCR 353
14 Antisense CCCAGAGTCCATGACAATACCAG q-PCR 481