Skip to main content

Advertisement

Table 1 Alternative assays used to compare efficiency and transversality of detection

From: Design and evaluation of a unique RT-qPCR assay for diagnostic quality control assessment that is applicable to pathogen detection in three species of salmonid fish

Assay N° Assay name Name Sequence (5′ - 3′) Reference
1   ELF1α For CCCCTCCAGGACGTTTACAAA [14]
1 ELF1α ELF1α Rev CACACGGCCCACAGGTACA [14]
1   FAM-ELF1α FAM- ATCGGCGGTATTGGAAC [14]
2   ELF1α GIM-1-For CCCCTCCAGGAYGTYTACAAA This work
2 ELF1α GIM-1 ELF1α GIM-1 Rev CACACGGCCCACRGGTACW This work
2   FAM- ELF1α GIM FAM-ATCGGYGGTAT + T + G + G + A + AC-BHQ This work
3   ELF1α GIM-2 For GCCCCTCCAGGAYGTYTACAA This work
3 ELF1α GIM-2 ELF α GIM-2 Rev CCACACGGCCCACRGGTAC This work
3   FAM-ELF1α GIM FAM-ATCGGYGGTAT + T + G + G + A + AC-BHQ This work
  1. Assay N°1 (ELF1α) is the current assay. Assays N°2 (ELF1α GIM-1) and N°3 (ELF1α GIM-2), use alternative primers and probes designed to test the objectives of this study. The FAM-ELF1α probe has MGB, and the FAM-ELF1α-GIM probe has LNA residues, denoted by a + symbol before the corresponding nucleotide.