Skip to main content

Table 2 Six validated specific miRNAs

From: Identification of neglected cestode Taenia multicepsmicroRNAs by illumina sequencing and bioinformatic analysis

Candidate Sequence Count Validated precursor
name    
tmu -novel-4 CAACTCTAATGTCCCGGGTTA 381 GCAATTCCTCCATGTCCCTGAGACCCTACAGTTGTCCGGAATTTGCATATCCACATTTCTCACGTGGCAACTCTAATGTCCCGGGTTATGAGGTTGTG
tmu -novel-9 TTCGGAGTTTTGGGTGAGGT 18 TTTGCTTATTTTCGGAGTTCTGGGTGAGGTGTCGTTTTTCATGCACAGCTCAATCAACTCCGATAGATTTGTGGGCTGC
tmu -novel-10 GGCTGATTTGTGGGGCTCAGAA 54 CTGCGCAAGAGGCTGATTTGTGGGGCTCAGAAAAGCTGCAAATGAAAACTTTTGGTCCCCATTAACCAGCCGCCTGCAGA
tmu -novel-12 TCAGGACGCTACATTGGTAG 7 TTCTCTGTGTTAAATATATGTTCTGCCCCAGTACCATGCCTTCTTTTGCCTTGAAGGAAATCTCGGGACGCTACATTGGTAGCAGCGGAAAA
tmu -novel-19 TGATCACTGTGCCGGCGTATT 140 ACGGCAGAGGAGTATTTGGGTGAGGAGGTGACAAATGCGGTTGTCACAGTGCCGGAGTATTTGGGTGAGGAGGTGACAAATGCGGTTGTCACAGTGCCGGCGTATTTTAGTGTCAG
tmu -novel-20 TTTAGCTAGTAGAGAAGTGG 30 CCGGGTTCCATTTAGCTAGTAGAAAATTAGGGTAGGACATTGCAAACCACTTAATTCAAATCTTTATGCAGGAACAGTGGACAGCTCCGT
  1. “Count” means the amount of the candidate novel miRNA. “Validated precursor” shows the corresponding precursor sequence obtained from genomic PCR validation.