Skip to main content

Table 1 Sequences and abundance of the top 10 miRNA families in T. multiceps

From: Identification of neglected cestode Taenia multicepsmicroRNAs by illumina sequencing and bioinformatic analysis

miRNA family name Sequencea Counts
miR-71 TGAAAGACGATGGTAGTGAGA 998673
miR-315 TTTTGTATTGTTGTTGGGATGTT 774438
miR-2840 TAGGACTGGAAGACGGGAGA 496050
miR-1 TGGAATGTTGTGAAGTATGT 469997
miR-1422 AATAAAATAGTAGGACTGAT 254527
bantam TGAGATCGCGATTACAGCTGAT 227564
miR-959 TAAGGACTTGGGTTGTAAAA 226286
miR-10 CACCCTGTAGACCCGAGTTTGA 208265
miR-4491 AATTGTGGATTGATGGACCAAA 176753
miR-4175 GGGATGTAGCTCAGTGGTAG 150022
  1. a miRNA sequence with the highest count in a single miRNA family.