Skip to main content

Table 2 The primers sequences used for insert DNA amplification of the VP2 and VP3 subunit genes by PCR

From: Expression and characterization of highly antigenic domains of chicken anemia virus viral VP2 and VP3 subunit proteins in a recombinant E. colifor sero-diagnostic applications

Subunit Primer name Type Sequence (5’-3’)
VP2-345N VP2-NEcoRI Forward TGGAATTCATGCACGGGAACGGCGGA
VP2-115C del XhoI Reverse TCCTCGAGTGATCGGTCCTCAAGT
VP2-396N VP2-NEcoRI Forward TGGAATTCATGCACGGGAACGGCGGA
VP2-131C del XhoI Reverse TCCTCGAGACCCTGTACTCGGAG
VP2-435N VP2-NEcoRI Forward TGGAATTCATGCACGGGAACGGCGGA
VP2-144C del XhoI Reverse TCCTCGAGCTGGGAGTAGTGGTAATC
VP2-171C VP2-170N del EcoRI Forward AGGAATTCATGGACGAGCTCGCAGAC
VP2-CXhoI Reverse TCCTCGAGCACTATACGTACCGG
VP2-318C VP2-111N del EcoRI Forward TGGAATTCATGGAGGACCGATCAACC
VP2-CXhoI Reverse TCCTCGAGCACTATACGTACCGG
VP3-123N VP3-N EcoRI Forward TGGAATTCATGAACGCTCTGCAGGAA
VP3-243C del XhoI Reverse TCCTCGAGTCAAGTAATGCCAGCGAT
VP3-246M VP3-123N del EcoRI Forward TGGAATTCATGATTACTCTGTCCCTG
  VP3-120C del XhoI Reverse TCCTCGAGTCATTTCGGCTGATCAGT
VP3-366C VP3-246N del EcoRI Forward TGGAATTCATGCCTCCGTCCAAGAAA
  VP3-C XhoI Reverse TCCTCGAGTTACAGGCGGATGCAACG
  1. Primer names describe the annealing locations of target genes and the restriction enzyme names used in expression plasmid cloning.