Skip to main content

Table 1 Sequence of primers used for Q-PCR analysis

From: Isolation and multilineage differentiation of bone marrow mesenchymal stem cells from abattoir-derived bovine fetuses

 Gene Sense Antisense Accession number
GAPDH 5′ CCTTCATTGACCTTCACTACATGGTCTA 5′ TGGAAGATGGTGATGGCCTTTCCATTG NM 001034034.2
βACTIN 5′CGCACCACTGGCATTGTCAT 5′TCCAAGGCGACGTAGCAGAG K00622.1
CD34 5′TGGGCATCGAGGACATCTCT 5′GATCAAGATGGCCAGCAGGAT AB021662
CD45 5′CCTGGACACCACCTCAAAGCT 5′TCCGTCCTGGGTTTTATCCTG NM 001206523
CD73 5′TGGTCCAGGCCTATGCTTTTG 5′GGGATGCTGCTGTTGAGAAGAA BC114093
CD90 5′CAGAATACAGCTCCCGAACCAA CACGTGTAGATCCCCTCATCCTT BC104530
CD105 5′CGGACAGTGACCGTGAAGTTG 5′TGTTGTGGTTGGCCTCGATTA NM 001076397
OC 5′ TGACAGACACACCATGAGAACCC 5′ AGCTCTAGACTGGGCCGTAGAAG EF673278.1
CD73 5′AATGGCACGATTACCTGGGA 5′GGGAGGATCACCTTGTACAC BT026240.1
ACAN 5′ CACTGTTACCGCCACTTCCC 5′ GACATCGTTCCACTCGCCCT NM 173981.2
COL2A1 5′ ATCCATTGCAAACCCAAAGG 5′ GACATCGTTCCACTCGCCCT NM 001113224.1
SOX9 5′CATGAAGATGACCGACGAG 5′ CGTCTTCTCCGTGTCGGA AF278703.1
AP2 5′ CTGGCATGGCCAAACCCA 5′ GTACTTGTACCAGAGCACC NM 174314.2
PPARγ 5′ CGCACTGGAATTAGATGACAGC 5′ CACAATCTGTCTGAGGTCTGTC BC116098.1
NANOG 5′ GTGTTTGGTGAACTCTCCTG 5′ GGGAATTGAAATACTTGACAG NM 001025344.1
OCT4 (1) 5′ ACACTCGGACCACGTCTTTC 5′ CGCATGGGTACCAGTGCACCTT AF022987
OCT4 (2) 5′ GTTCTCTTTGGAAAGGTGTTC 5′ ACACTCGGACCACGTCTTTC AY490804.1
  1. (1) and (2) represents sets of primers used for OCT4 mRNA amplification.