Skip to main content

Table 2 Primers used for RT-qPCR

From: Expression and role of PGP, BCRP, MRP1 and MRP3 in multidrug resistance of canine mammary cancer cells

Gene symbol Forward primer Reverse primer Optimum annealing temp. (°C) Optimum annealing time (sec)
pgp GCTTAACACCCGGCTCACAGAC TAAGAAAGCGGCACCAATAGAAAT 72 10
bcrp GAGCTCCTTGTGGTTGAGAA AGGTGATGGTCATGAGGAGA 72 10
mrp1 TTTACTTTTCCCTCGTGCTG TATTCAGGGACCAAAGGTCA 72 45
mrp3 AGGATGGACCTGATGACAGA AACTTGGGAATCAGGAGACC 72 30
hprt AGCTTGCTGGTGAAAAGGAC TTATAGTCAAGGGCATATCC 59 6
rps19 CCTTCCTCAAAAAGTCTGGG GTTCTCATCGTAGGGAGCAAG 61 10
  1. Primer sequences used in this study and their annealing optimal temperature and time. The mRNA sequences of key genes were obtained from NCBI database. Primers were designed using PRIMER3 software (free on-line access) and checked using Oligo Calculator (free on-line access) and Primer-Blast (NCBI database). Primers sequences are listed in Table 1. hprt and rps19 genes were used as non-regulated reference genes for normalization of target gene expression [22, 23].