Skip to main content

Table 6 Primers and probes used to identify TNF-α, LTF and mLYZ genotypes

From: Parity-dependent association between TNF-α and LTF gene polymorphisms and clinical mastitis in dairy cattle

TNF-α
Forward primer CCCTTCTCCAGCTGGAAGA
Rewerse primer ATCTCAGCACTGAGGCGATC
SimpleProbe CCTGGTACGAACCCAXITCTACCA - PH
LTF
Forward primer TCATGTTAAGTCACCTGAAATGGTA
Rewerse primer AGTATGCTGAATATGATACTGGCA
SimpleProbe CCCAAGTCCATCTATGCATTCCCAG
mLYZ
Forward primer GCTGAGGAAAGAACAACTAAAATAAT
Rewerse primer CTTGAGTGATGTCATCTTGCAG
SimpleProbe CCATCAACAGAXITAAACAGCCCTTAA - PH