Skip to main content

Table 1 Oligonucleotide primers employed in this study

From: Differentially expressed proteins in the skin mucus of Atlantic cod (Gadus morhua) upon natural infection with Vibrio anguillarum

Gene name   Sequence (5’-3’) Primer Purpose Acc.
    efficiency (%)   number
Profilin2 (Pfn2) F1 CCAGCCACTCAATATGTCGT   cloning [GenBank:KC460541]
R2 CAAGAACCTGGGAAACACAC
  F ATCGCAGCACTTTATTCACC 95.18 qPCR  
R GCGTCCTCCTTGTAGAGGTT
Peroxiredoxin 6 (Prdx6) F TATCGGTGAGACAGGACCAT   cloning [GenBank:KC460539]
R TGGCGGTTTATTCTAAGTGC
  F GATGAGATCGACAAGGATGG 96.99 qPCR  
R TCTATGACCCTCAGCAGCTC
Flotillin1 (Flot1) F TCGCTGAAATAGGTCTCTGG   cloning [GenBank:KC460542]
R ACTCAGCCTTCTTGGTGTTG
  F ACCAGGACTACCTCCACTCC 91.88 qPCR  
R TACTGGGCAGACACCTTCTC
Calpain small subunit 1 (Capns1) F TTCTCTTCTCACCGCAGAAC   cloning [GenBank:KC460540]
R GACTTTTCCAGCTCCTCCTC
  F AACATGGCAACATGGACTTT 94.05 qPCR  
R TTGACATCAAGGGAGATGGT
Beta 2 Tubulin (Tubb2) F CAGCTACTTCGTGGAATGGA 94.47 qPCR [GenBank:AAD56401]
R CTGTTGCCGATGAAGGTTAC
Cold inducible RNA binding protein (Cirbp) F CTCTTCGGAACTCTCAACCA   cloning [GenBank:KC460543]
R AATACAGCCAGCCAAGTGAC
  F GTATGGAAACATCGCCAAAG 94.17 qPCR  
R CTCGTCGGCATTATCAAACT
Glutathione S-transferase omega1(Gsto1) F ATTGCGTCTTGGTCATTCAT   cloning [GenBank:KC460544]
R ACAGGCCATAGTCGTAGTCG
  F CTGAAACACTTCCTGGATGG 95.60 qPCR  
R GCGTGCATGGTTTCTTTAAC
Ubiquitin (Ubi) F GGCCGCAAAGATGCAGAT 96.10 qPCR [GenBank:EX735613]
R CTGGGCTCGACCTCAAGAGT
Acidic ribosomal protein (Arp) F TGATCCTCCACGACGATGAG 95.37 qPCR [GenBank:EX741373]
R CAGGGCCTTGGCGAAGA
Interleukin 1β (il1β) F GGAGAACACGGACGACCTGA   qPCR [GenBank:AJ535730]
  R CGCACCATGTCACTGTCCTT    
  1. 1Forward primer.
  2. 2 Reverse primer.