Skip to main content

Table 3 Primer sequences used for RT-qPCR validation procedure

From: Increased hypoxia-inducible factor 1α expression in lung cells of horses with recurrent airway obstruction

Genes Equine accession number Primers sequence Product size (bp)
   5′--------------------------------- > 3′  
Targets
Hif1-α LOC100061166 Forward ctcaaatgcaagaacctgctc 108
Reverse ttccataccatcttttgtcactg
VEGF-α NM_001081821 Forward tggcagaaggagagcataaaa 123
Reverse actcgatctcatcggggtact
IL-8 NM_001083951 Forward aatgagagcgattgagagtgg 127
Reverse caaaaacgcctgcacaataat
TNF-α EU438779 Forward agcctcttctccttcctcctt 123
Reverse cagagggttgattgactggaa
Housekeeping gene
ACTB NM_001081838.1 Forward ggacctgacggactacctc 81
  Reverse cacgcacgatttccctctc
GAPDH NM_001163856 Forward atctgacctgccgcctggag 70
Reverse cgatgcctgcttcaccaccttc
HPRT XM_001490189.2 Forward aattatggacaggactgaacgg 121
Reverse ataatccagcaggtcagcaaag
RPL32 None Forward gggagcaataagaaaacgaagc 113
Reverse cttggaggagacattgtgagc
SDHA XM_001490889.3 Forward gaggaatggtctggaatactg 91
Reverse gcctctgctccataaatcg