Skip to main content

Table 1 The primer sequences used for RT-PCR

From: Characterization of vascular endothelial progenitor cells from chicken bone marrow

Name Sequence Length (bp) Tm°C
CD34 F:5′GTGCCACAACATCAAAGACG 3′
R: 5′GGAGCACATCCGTAGCAGGA 3′
239 60
VEGFR-2 F: 5′ GGTCGCATGAACATGAAGAA3′
R: 5′ TTGGTAGGGTTTGTAAGGAC3′
248 58
α-MSA F: 5′AGCACCACTGAATCCCAAAG3′
R: 5′AGTCCAGGGCCACATAACAC3′
347 58
GAPDH F:5′ TAAAGGCGAGATGGTGAAAG 3′
R: 5′ ACGCTCCTGGAAGATAGTGAT 3′
244 60