Skip to main content

Table 6 Primers and probes for multiplex real-time RT-PCRa

From: One-step multiplex real time RT-PCR for the detection of bovine respiratory syncytial virus, bovine herpesvirus 1 and bovine parainfluenza virus 3

Viruses Primers/probes Sequences (5'-3')
BPI3 i BPI3euro Forward GGTAGGAGCACCTCCACGATT
  BPI3euro Reverse GCTCCAAGGCATGCTGGATA
  BPI3euroMGB VIC-AAGATCTTGTTCACACATTC-MGB-NFQ
BPI3 ii BPI3 Forward2 TGATTGGATGTTCGGGAGTGA
  BPI3Reverse2 AGAATCCTTTCCTCAATCCTGATATACT
  BPI3Fam FAM-TACAATCGAGGATCTTGTTCA-MGB-NFQ
BRSV [14] BRSVn Forward GGTCAAACTAAATGACACTTTCAACAAG
  BRSVn Reverse AGCATACCACACAACTTATTGAGATG
  BRSVLNACyan500 Cyan500-TAGTACAGGTGACAA+CA+T+TG-BBQ
BoHV-1 [15] gB Forward TGTGGACCTAAACCTCACGGT
  gB Reverse GTAGTCGAGCAGACCCGTGTC
  gBCy5 Cy5-AGGACCGCGAGTTCTTGCCGC-BHQ2
β-actin Bac1F_uni GACAGGATGCAGAARGAGATCAC
  Bac2R_uni TCCACATCTGCTGGAAGGTG
  β-actin FAM-MGB FAM-TGAAGATCAAGATCATCG-MGB-NFQ
  1. a All the primers and probes are obtained from Applied Biosystems (Warrington, UK) except BRSV LNAcyan500 probe (TIB Molbiol,Berlin, Germany) and gBCy5 probe (Eurofins MWG Operon, Germany).
  2. Abbreviations: BHQ black hole quencher, MGB-NFQ minor groove binding-non fluorescent quencher, LNA locked nucleic acid, BBQ Blackberry quencher.