Skip to main content

Table 2 Characteristics and performance data of the primers used for reference gene-stability measure M and quantitative real-time PCR analysis

From: Expression of genes involved in hepatic carnitine synthesis and uptake in dairy cows in the transition period and at different stages of lactation

Gene Forward primer (from 5' to 3') PCR product NCBI GenBank Slope R2 Efficiency M
  Reverse primer (from 5' to 3')       
Reference genes        
ACTB ACTTGCGCAGAAAACGAGAT 120 AY141970 -0.30 0.99 1.99 0.039
  CACCTTCACCGTTCCAGTTT       
SDHA GCAGAACCTGATGCTTTGTG 185 NM_174178 -0.24 0.99 1.74 0.048
  CGTAGGAGAGCGTGTGCTT       
ATP5B GGACTCAGCCCTTCAGCGCC 229 NM_175796.2 -0.16 0.99 1.44 0.039
  GCCTGGTCTCCCTGCCTTGC       
RPS9 GTGAGGTCTGGAGGGTCAAA 108 BC148016 -0.31 0.99 2.04 0.040
  GGGCATTACCTTCGAACAGA       
PPIA GGCAAATGCTGGCCCCAACACA 87 NM_178320.2 -0.34 0.99 2.13 0.034
  AGTACCACGTGCTTGCCATCCA       
RPL12 CACCAGCCGCCTCCACCATG 84 NM_205797.1 -0.35 0.99 2.25 0.036
  CGACTTCCCCACCGGTGCAC       
Target genes        
ACADM GCGAGTACCCTGTCCCATTA 243 NM_001075235 -0.29 0.99 1.93  
  CCTCAGTCATTCTCCCCAAA       
ACOX1 CCATTGCCGTCCGATACAGT 99 BC102761 -0.27 0.96 1.88  
  GTTTATATTGCTGGGTTTGATAATCCA       
ALDH9A1 CAGGATTCGGCAGAGAGAAC 229 NM_001046423 -0.28 0.99 1.90  
  TGAGCCATGAAGAGCATCAC       
BBOX1 TCCAGCTGCCTACTCTGGAT 292 BC149884.1 -0.28 0.99 1.91  
  AGCTGAACCTTACCCCAGGT       
CD36 GCATTCTGAAAGTGCGTTGA 179 BC103112 -0.28 0.98 1.91  
  CGGGTCTGATGAAAGTGGTT       
CPT1A CAAAACCATGTTGTACAGCTTCCA 111 FJ415874 -0.32 0.99 2.09  
  GCTTCCTTCATCAGAGGCTTCA       
HMGCS2 GCCCAATATGTGGACCAAAC 209 NM_001045883 -0.29 0.99 1.96  
  ATGGTCTCAGTGCCCACTTC       
PPARA GGTGGAGAGTTTGGCAGAACCAGA 168 BT020756.1 -0.23 0.99 1.70  
  TCCCACTGCCCAGCTCCGATC       
SLC22A5 CACAGTGGTCAGGAACATGG 181 BC105377 -0.28 0.99 1.89  
  AATGGTGTCTGGGAGTGGAG       
SLC27A1 CTGAAGGAGACCTCCACAGC 208 NM_001033625.2 -0.30 0.99 1.99  
  GTGGTACAGGGGCAGACAGT       
TMLHE TGGCAGGACACTGCTAGTTG 222 NM_001076064.1 -0.31 0.99 2.05  
  GACAGCCCGGTCATAGTTGT