Skip to main content

Table 2 Salmonella virulence genes detected by PCR analysis

From: Diversity of Salmonellaspp. serovars isolated from the intestines of water buffalo calves with gastroenteritis

Gene Function Primer sequence (5 – 3) bp Reference
avrA Inhibits the proinflammatory, antiapoptotic NF-kappa B pathway CCTGTATTGTTGAGCGTCTGG 422 [8]
   AGAAGAGCTTCGTTGAATGTCC   
ssaQ Secretion system apparatus protein, component of second T3SS AATGAGCTGGGTAGGGTGTG 216 This study
   ATGCAACGCTAGCTGATGTG   
mgtC Intramacrophage survival protein TGACTATCAATGCTCCAGTGAAT 677 [8]
   ATTTACTGGCCGCTATGCTGTTG   
siiD HLYD family secretion protein GTTCATGGTCAGGGCGTTAT 416 This study
   GCAAGCAATGCGAGTTCTTT   
sopB Translocated effector protein (phosphoinositide phosphatase) via T3SS TAACGTCAATGGCAAACCAA 334 This study
   CCCTCATAAGCACTGGGAAA   
gipA Peyer’s patch-specific virulence factor GCAAGCTGTACATGGCAAAG 212 [9]
   GGTATCGGTGACGAACAAAT   
gogB Type III-secreted substrate of the infection process GCTCATCATGTTACCTCTAT 598 [10]
   AGGTTGGTATTTCCCATGCA   
sopE Translocated T3SS effector protein CGAGTAAAGACCCCGCATAC 363 [10]
   GAGTCGGCATAGCACACTCA   
gtgB Translocated T3SS effector protein TGCACGGGGAAAACTACTTC 436 [9]
   TGATGGGCTGAAACATCAAA   
sspH1 Salmonella secreted protein H1 TGCAGAAAAAGGGGAATACG 246 This study
   GCAGCCTGAAGGTCTGAAAC   
sspH2 Salmonella secreted protein H2 GCACAACTGGCTGAAGATGA 203 This study
   TTTCCCAGACGGAACATCTC   
gtgE SPI2 type III secreted effector protein AGGAGGAGTGTAAAGGT 1114 [11]
   GTAGAACTGGTTTATGAC   
sodC1 Periplasmmic Cu, Zn-superoxide dismutases TATTGTCGCTGGTAGCTG 468 [11]
   CAGGTTTATCGGAGTAAT   
spvC Spv region promotes rapid growth and survival within the host ACTCCTTGCACAACCAAATGCGGA 571 [12]
   TGTCTTCTGCATTTCGCCACCATCA   
invA Enables the bacteria to invade cells ACAGTGCTCGTTTACGACCTGAAT 244 [12]
   AGACGACTGGTACTGATCGATAAT   
stfE Minor fimbrial subunit of the Salmonella Typhi flagella ATTTGGCAATGTGTTGACGA 185 This study
   TTTGCAGACGGATACCCAAT   
safC Pilin outer membrane usher protein CTCGCTGTCATTGAACTGGA 158 This study
   CACCGTGTGATGGTGAAGTC   
csgA Major fimbrial subunit of thin curled fimbriae GGATTCCACGTTGAGCATTT 212 This study
   CGGAGTTTTTAGCGTTCCAC   
ipfD The Ipf fimbrial operon mediates adhesion to Peyer’s patches TTCCCTCAATACGCAGGAAG 183 This study
   CTCAGGGCTGTGAACTCTCC   
bcfC Bovine colonization factor, fimbrial usher CAGCTTTTCATGACGCGATA 241 This study
   CAATGTCTCTGGTTGCGAGA   
stbD Stability protein involved in a toxin-antitoxin system and in plasmid stability GGCTGTAATATTCGCCGGTA 201 This study
   GCACGCCCTATTCCAGTAAA   
pefA Major fimbrial subunit of the plasmid encoded fimbria ACACGCTGCCAATGAAGTGA 450 [18]
   ACTGCGAAAGATGCCACAGA   
fimA Type 1 major fimbrial unit CCTTTCTCCATCGTCCTGAA 85 This study
   TGGTGTTATCTGCCTGACCA   
agfA Aggregative fimbria A GGATTCCACGTTGAGCATTT 312 [18]
   GTTGTTGCCAAAACCAACCT