Skip to main content

Table 1 Characteristics of the two multiplex MLVA assays

From: Molecular typing of Coxiella burnetii from animal and environmental matrices during Q fever epidemics in the Netherlands

Locus Primers MLVA primer sequence and label (5′-3′)   Repeat sequence Repeat length (bp)   Sequencing primers (5′-3′)
  Multiplex assay 1     
Ms27 (Cox2) Forward primer NED-CGCTATTTTTTCAGTTTTGAGTAA TGAAGA 6 CAGTGCGTCCAGATTTCATTG
  Reverse primer GTCGCAAACGTCGCACT GTCCGGATACAGCTTGAAAAGT
Ms28 (Cox5) Forward primer VIC-CGATGACGACAAAAAAGACT TAAGAA 6 GCAGAAAAAGAACATGAATGTGATTGTG
  Reverse primer GCGGTAATTACTGTAAATAAATACAAAGACA GCCGGTAMCCTTCTCTAAATATTGCAA
Ms34 (Cox1) Forward primer 6FAM-ATCAGCGACTCGAAGAAAAA GAAAAG 6 CCAGTATCTCGTACGTCTCRATTT
  Reverse primer AGGGTGACTTTTTCACTTAAAG CGTTTGAACACGCAACTGTTTT
  Multiplex assay 2     
Ms20b Forward primer VIC-TGTAACAGCACCGCCTGA GGAAGAAGCGCCACCCG 33 ACAGGTGAGTCGCCATTAACG
  Reverse primer GCTTTGCCCTTTCCTTGATTTTC AAATAGGGTTGCCTCC CCATTGGGATCAAGTTCATGACTAT
Ms24 (Cox4) Forward primer NED-CCATTGTGTAATTGACATGAAGAA GACGGAA 7 TATGCGCATCTTCTCGGAGCA
  Reverse primer GCCACACAACTCTGTTTTCAG GCGCTCCTTCCTCCTGTAAG
Ms31 (Cox7) Forward primer 6FAM-CCGGTATTCTAACCAACTGAAC CAGAGGA 7 AGATAAAAAGAAAAAGCAACCCGTGAA
  Reverse primer GAATCCCTCAGCACCCATTC GGGTGCGTTTCCAAAAATAGTATAGG
  1. Per assay, three different primer sets, labeled with different fluorescent dyes, target three different loci. Loci are indicated by their previously published names: Ms [9], and Cox [10]. The sequencing primer sets were used for sequencing MLVA motifs.
\