Skip to main content

Advertisement

Table 1 Primers designed to amplify the remaining sequence of pNoVs-Ch6

From: Recombinant porcine norovirus identified from piglet with diarrhea

Primer name Nucleotide position Nucleotide sequence (5-3)
PNoV1F 725-744 ACCTGTCCCTACAGTGGATG
PNoV1R 1494-1513 ATATGAGTTTTGCCTATACC
PNoV2F 1404-1425 ATCTCAGCAGCCAGGTCGCTCC
PNoV2R 2154-2173 AACCCATACCTATTGTCAGC
PNoV3F 2107-2126 TCTACAACTTCGATGTGGAC
PNoV3R 2826-2845 TGACGGAGTCTCATCTCATC
PNoV4F 2744-2762 CGAGGAGTACCTCCGTGAC
PNoV4R 3552-3571 TGATTCTCACCACCCTCCAG
PNoV5F 3525-3543 ACTCAGGGTCCTGATGGTG
PNoV5R 4298-4318 TGCCTCTCTGTTGGGTGGAG
PNoV6F 4261-4279 ATACCTACCACTTTGATGC
PNoV6R 4884-4902 ATGAGGCTTCTCCCAGCAGG
5endF 1-23 GTGAAATGAAGATGGCGTCTAAC
5endR 761-780 ATAGAATCACGTTGGCAACC
3endF1(external forward primer) 7009-7031 ACTGGAATGGCACGAGATACTGG
5endF2(internal forward primer) 7193-7212 ACTCTATGGGTACCTCTAG
5endR   TTTTTTTTT
  1. Position and nucleotide sequence of oligonucleotide primers for PCR. The nucleotide position is in accordance with AB126320. In the primer names, F and R mean sense primer and anti-sense primer, respectively.