Skip to main content

Table 1 Primers designed to amplify the remaining sequence of pNoVs-Ch6

From: Recombinant porcine norovirus identified from piglet with diarrhea

Primer name Nucleotide position Nucleotide sequence (5-3)
3endF1(external forward primer) 7009-7031 ACTGGAATGGCACGAGATACTGG
5endF2(internal forward primer) 7193-7212 ACTCTATGGGTACCTCTAG
  1. Position and nucleotide sequence of oligonucleotide primers for PCR. The nucleotide position is in accordance with AB126320. In the primer names, F and R mean sense primer and anti-sense primer, respectively.