Skip to main content

Table 2 The primers used to create the various truncated, single and multiple mutants by PCR in this study

From: Identification of the NLS and NES motifs of VP2 from chicken anemia virus and the interaction of VP2 with mini-chromosome maintenance protein 3

Primer name Type Length Sequence (5'-3')
VP2 111 N del EcoRI Forward 26-mer TGGAATTCATGGAGGACCGATCAACC
VP2 141 N del EcoRI Forward 26-mer AGGAATTCATGCACTACTCCCAGCCG
VP2 160 N del EcoRI Forward 26-mer AGGAATTCATGGACGAGCTCGCAGAC
VP2 115 C del XhoI Reverse 24-mer TCCTCGAGTGATCGGTCCTCAAGT
VP2 132 C del XhoI Reverse 23-mer TCCTCGAGACCCTGTACTCGGAG
VP2 145 C del XhoI Reverse 26-mer TCCTCGAGCTGGGAGTAGTGGTAATC
VP2 136-138A Forward 27-mer AAACGAGCTGCTGCTGCTCTTGATTAC
VP2 136-138A Reverse 27-mer GTAATCAAGAGCAGCAGCAGCTCGTTT
VP2 150-152A Forward 39-mer ACCCCGAACGCAGCAGCAGTGTATAAGACTGTAAGATGG
VP2 150-152A Reverse 39-mer CCATCTTACAGTCTTATACACTGCTGCTGCGTTCGGGGT
VP2 136-138A/134/A Forward 27-mer GTACAGGGTAAAGCTGCTGCTGCTGCT
VP2 136-138A/134/A Reverse 27-mer AGCAGCAGCAGCAGCTTTACCCTGTAC
VP2 136-138A/133/A Forward 27-mer GTACAGGGTGCTCGAGCTGCTGCTGCT
VP2 136-138A/133/A Reverse 27-mer AGCAGCAGCAGCTCGAGCACCCTGTAC
VP2136-138A/133A/134/A Forward 27-mer GTACAGGGTGCTGCTGCTGCTGCTGCT
VP2 136-138A/133A/134/A Reverse 27-mer AGCAGCAGCAGCAGCAGCACCCTGTAC
VP2 133A Forward 28-mer GTACAGGGTGCTCGAGCTAAAAGAAAGC
VP2 133A Reverse 28-mer GCTTTCTTTTAGCTCGAGCACCCTGTAC
VP2 134A Forward 28-mer GTACAGGGTAAAGCTGCTAAAAGAAAGC
VP2 134A Reverse 28-mer GCTTTCTTTTAGCAGCTTTACCCTGTAC
VP2 133A/134A Forward 28-mer GTACAGGGTGCTGCTGCTAAAAGAAAGC
VP2 133A/134A Reverse 28-mer GCTTTCTTTTAGCAGCAGCACCCTGTAC
VP2 C95S Forward 20-mer CGCTAAGATCAGCAACTGCG
VP2 C95S Reverse 22-mer CGCAGTTGCTGATCTTAGCGTG
VP2 C97S Forward 21-mer ATCTGCAACAGCGGACAATTC
VP2 C97S Reverse 24-mer ATTGTCCGCTGTTGCAGATCTTAG
VP2 C95S/C97S Forward 28-mer CGCTAAGATCAGCAACAGCGGACAATTC
VP2 C95S/C97S Reverse 28-mer ATTGTCCGCTGTTGCTGATCTTAGCGTG