Skip to main content

Table 2 Details of oligonucleotide primers used for RT-LAMP assay

From: Reverse transcription loop-mediated isothermal amplification assay for rapid detection of Bovine Rotavirus

Primer name sequence(5’-3’) Genome position
FIPa = F2 + F1c GTTGTGATCTGTTCAACGTGAATGA-gaattc-GGGTTTTACATTTCATAAACCAA F1c,510-534
F2,467-489
BIPb = B2 + B1c GCTCATGATAACTTGATGGG- gatatc-GCACATGAGTAGTCGAATCC B1c,537-556
B2,597-616
F3 TTGCAAAATAGAAGACAAAGAAC 444-466
B3 GTTGCGTATTAGCTGGCG 625-642
LoopF CTGAATAAGGGAAAATGTTTGGTTT 483-507
loopB GATGTGGCTCAATGCGGG 560-577
  1. Genome position according to the bovine rotavirus complete genome sequence (GenBank accession no. K02254.1).
  2. a FIP is composed of F2 and F1c, and they are linked by a sequences of EcoRIof -gaattc-.
  3. b BIP is composed of B2 and B1c, and they are linked by a sequences of EcoRV of -gatatc-.