Skip to main content

Advertisement

Table 3 Gene name, product size, and forward and reverse primer sequences of GeXP assays of chicken spleen

From: Co-administration of avian influenza virus H5 plasmid DNA with chicken IL-15 and IL-18 enhanced chickens immune responses

Gene name Fragment size Left sequence without universalsc Right sequence without universalsd
IL-15 187 AAGGTTTCCGAGGCTTGTACC GTTTTCTGACTCTCCGGCCT
IL-12β 194 TGAAGGAGTTCCCAGATGCT AAGAACGTCTTGCTTGGCTC
IL-2 201 TAGTCACGAGGGGACCTTTG GACGGCTTTCTTTGATGAGC
IL-1β 208 TCTTTGGCTGTATTTCGGTAGC TGCACTCCTGGGTCTCAGTT
IL-18 215 CAAAGTGTACACCATCCTGGAA AAAGACGATTCCGCTTTCTTC
IL-4 222 CAAGTCAAAGCCGCACATC GAGGATCCACCAGCTTCTGT
IL-6 236 TCAACATCGCCACCTACAAG TAAAAGCAACGGGACGGTAA
IL-10 243 GCTTGTGGTTCGTCCAGATT GAACAACCATTTTCCCATGC
IL-8 250 GAGCATCCGGATAGTGAATGA TTGAGGGAGGTGCTGCTG
IFN-γ 257 CAACGCAGAAGAAACAGTGC CCCCATTGCAAATGTTGTATC
TNFSF13B 264 AGCCACAGCATCTTCTTCGT TCGAAGGAGAGCCACTCATC
TGFβ 271 CAACCCCCAATGTCTCTGTT ACCAGGAAACAAGCTTGACG
GMCSF 279 CCGTTTCAGGAACCAGAGAG GTCTGGCTGCTGGACATTTT
COL6A2a 287 ATTTTCAATCCAGGGACGAT CTCCTCTTCTCGCAGGTGAA
KANb 325 ATCATCAGCATTGCATTCGATTCCTGTTTG ATTCCGACTCGTCCAACATC
  1. a Gene used for normalization.
  2. b Internal control.
  3. c Forward universal primer sequence (AGGTGACACTATAGAATA).
  4. d Reverse universal primer sequence (GTACGACTCACTATAGGGA).