Skip to main content

Table 3 Primers used in the cRT-PCR assays

From: Development of one-step TaqMan® real-time reverse transcription-PCR and conventional reverse transcription-PCR assays for the detection of equine rhinitis A and B viruses

cRT-PCR Assay Name Primer Names Sequence 5' to 3' and Nucleotide Location (nt) Genbank Accession Number Reference
ERAV 5′UTR ERAV 5′UTR F TCAGCCCCCTGTCATTGACT (341-360) NC_003982 This study
  ERAV 5′UTR R TGRaTCAGGGCTGTAACCA (769-786)   
ERAV Poly ERAV Poly F TGGATGAAGTGGTTTTTGC (6384-6402)   
  ERAV Poly R CAGTCAAAGCCTGGTTGTCA (6502-6521)   
ERAV Poly2 ERAV Poly F TGGATGAAGTGGTTTTTGC (6384-6402)   
  ERAV Poly R2 ACTCTCATTGCATCAGCTGC (6977-6996)   
ERBV 5′ UTR ERBV 5′UTR F TTTCGTTCCWbCTTTAGCRaGG (349-368) NC_003983  
  ERBV 5′UTR R TCAGATCCGCACTCTATGAAG (764-784)   
ERBV OUTER1 ERBV OUTER F TTTTGATGCTTCACATTCTCC (7986-8006)   [27]
  ERBV OUTER R CGCTGTACCCTCGGTCCTACTC (8746-8767)   
ERBV OUTER2 ERBV OUTER F TTTTGATGCTTCACATTCTCC (7986-8006)   
  ERBV INNER R GCCTCGGCGAGTGAAGAG (8721-8739)   
ERBV INNER1 ERBV INNER F CTTACTAYcGAATGTGARGGGGC (8117-8138)   
  ERBV INNER R GCCTCGGCGAGTGAAGAG (8721-8739)   
ERBV INNER2 ERBV INNER F CTTACTAYGAATGTGARGGGGC (8117-8138)   
  ERBV OUTER R CGCTGTACCCTCGGTCCTACTC (8746-8767)   
ERBV Poly1 ERBV Poly F TTGAGTTGACCCTTCTGCA (7409-7427)   This study
  ERBV Poly R TCATACTCTGAAATGRaKdTCCATTG (7530-7553)   
ERBV Poly2 ERBV Poly F TTGAGTTGACCCTTCTGCA (7409-7427)   
  ERBV Poly R2 GCTGAACCAATGCCTAATCC (7879-7898)   
  1. a R represents A or G.
  2. b W represents A or T.
  3. c Y represents C or T.
  4. d K represents G or T.
\