Skip to main content

Table 2 Primers and probes used in the rRT-PCR assay developed by Quinlivan et al . (2010)

From: Development of one-step TaqMan® real-time reverse transcription-PCR and conventional reverse transcription-PCR assays for the detection of equine rhinitis A and B viruses

rRT-PCR Assay Name Target Genes (GenBank Accession Number) Primer or Probe Namesa Sequence 5' to 3' and Nucleotide Location Length of Fragment (bp)
ERAV 5'-UTR of ERAV (NC_003982) ERAV 468F CCAGGTAACCGGACAGCG (468-485) 118
   ERAV 569R GGCAGCGCTACCACAGG (569-585)  
   ERAV 508b FAMb-CATTGCTCTGGATGGTGT-MGBc (508-525)  
ERBV 5'-UTR of ERBV (NC_003983) ERBV 77F TGATGCTTGGCTCTCAGAAA (77-96) 132
   ERBV 189R GCAAACGACCAACACATCAA (189-208)  
   ERBV 171b FAMb-CTTCCAACTAAACCC-MGBc (171-185)  
  1. aF = Forward primer. R = Reverse primer. Pr = Probe.
  2. bReporter dye (FAM; 6-carboxyfluorescein) labeled nucleotide.
  3. cNonfluorescent quencher dye (MGB™; minor groove binding) labeled nucleotide.