Skip to main content

Table 1 Primers and probes used in the rRT-PCR assays

From: Development of one-step TaqMan® real-time reverse transcription-PCR and conventional reverse transcription-PCR assays for the detection of equine rhinitis A and B viruses

rRT-PCR Assay Name Target Genes (GenBank Accession Number) Primer or Probe Namesa Sequence 5' to 3' and Nucleotide Location Length of Fragment (bp)
ERAV 5'-UTR of ERAV (L43052) ERAV F AGCGGCKdTGCTGGATTTTC (397-415) 60
   ERAV R CATYeTGYCAGCTTGGTGACA (438-457)  
   ERAV Pr FAMb-CGGTGCCATTGCT-MGBc (417-429)  
ERBV1 5'-UTR of ERBV1 (NC_003983) ERBV1 F CCCCTTfCCCTGAAGATTGCT (148-167) 61
   ERBV1 R GGCAAACGACCAACACATCA (190-209)  
   ERBV1 Pr FAM-TTCTTCCAACTAAACCC-MGB (169-185)  
ERBV2 5'-UTR of ERBV2 (NC_003077) ERBV2 F CCCCAACCCTTGAGATTGCT (148-167)  
  1. aF = Forward primer. R = Reverse primer. Pr = Probe.
  2. bReporter dye (FAM; 6-carboxyfluorescein) labeled nucleotide.
  3. cNonfluorescent quencher dye (MGB™; minor groove binding) labeled nucleotide.
  4. dK represents G or T.
  5. eY represents C or T.
  6. f Nucleotide difference between the forward primers of ERBV1 and ERBV2 are in bold.
\