Skip to main content

Table 1 Primers used for semi-quantitative RT-PCR and RACE

From: Transcriptome analysis of head kidney in grass carp and discovery of immune-related genes

Primer Sequence (5′ to 3′) Application
788-R1 GACTCTTCCGGCACGTAACT Expression study
β-actin-F CAGATCATGTTTGAGACC Expression study
β-actin-R ATTGCCAATGGTGATGAC Expression study