Skip to main content

Table 2 Primers and TaqMan® probes

From: Assessment of a novel multiplex real-time PCR assay for the detection of the CBPP agent Mycoplasma mycoides subsp. mycoidesSC through experimental infection in cattle

Target Primers/Probes Sequence (5'-3') Position2
IppQ
MSC_0136
IAC
MSC_1046-S
MSC_1046-R2
MSC_1046-TM1
MSC_0136-F
MSC_0136-R
MSC_0136-TM
EGFP-1F
EGFP-10R
EGFP-Hex
ATCAAGATATTTCGAGTTGAAATGTAAG
TGTATATTTTTTAGATTTCAATCTGAAAGTG
FAM-TTTCAGCTCGATAAAACATATTT-BBQ1
AACACAAAAAACCGAACAGCCT
AGCTTATCAGGAACTTTTTTAACGTA
Cy5-TGAGATAGTTCAAATTGGCTTT-BBQ1
GACCACTACCAGCAGAACAC
CTTGTACAGCTCGTCCATGC
HEX-AGCACCCAGTCCGCCCTGAGCA-BHQ1
1166686-1166713
1190443-1190470
1166797-1166767
1190554-1190524
1166754-1166732
1190511-1190489
159994-160015
1023331-1023310
160131-160106
1023194-1023219
160042-160063
1023283-1023262
  1. 1Locked nucleic acid (LNA) containing nucleotides are underlined,2Based on GenBank sequence BX293980