Skip to main content

Advertisement

Table 1 Primer sequences and UPL probes used for qRT-PCR amplification of selected target and reference genes.

From: Matrix metalloproteinases and their inhibitors in canine mammary tumors

Genes Accession number Primer sequence (5'-3') UPL probe
MMP-2 [GenBank:XM_535300.2] F: gggaccacggaagactatga R: atagtggacatggcggtctc 29
MMP-9 [GenBank:NM_001003219.1] F: tgagaactaatctcactgacaagca R: gctcggccacttgagtgta 6
MMP-13 [GenBank:XM_536598.2] F: ctcttcttctcgggaaacca R: gcctggggtagtctttatcca 50
MT1-MMP [GenBank:XM_843664.1] F: gatctgaatgggaatgacatctt R: gatggccgagggatcatt 76
TIMP-1 [GenBank:NM_001003182.1] F: cagggcctgtacctgtgc R: cctgatgacgatttgggagt 112
TIMP-2 [GenBank:NM_001003082.1] F: atgagatcaagcagataaagatgttc R: ggaggaaggagccgtgtag 93
TIMP-3 [GenBank:XM_538410.2] F: tgctgacaggccgcgt R: gcagttacagcccaggtga 14
RECK [GenBank:NM_001002985.1] F: aaggggtgtctgtctggagat R: cccaatttgcaaccttgaac 97
CGI-119 [GenBank:XM_531662.2] F: tctacaatctaagagagatttcagcaa R: ttcctgacaagcacaaaatcc 15
GOLGA-1 [GenBank:XM_537849.2] F: ggtggctcaggaagttcaga R: tatacggctgctctcctggt 149
  1. F: forward; R: reverse