Skip to main content

Advertisement

Table 3 Sequence, concentration and position of specific oligonucleotide probes for B. burgdorferi sensu lato

From: Detection and differentiation of Borrelia burgdorferi sensu lato in ticks collected from sheep and cattle in China

Type of primers and isolate Oligonucleotide Sequence(5'-3') Concentration used (pmol) Position on 5S-23S intergenic spacer region
23SN1 ACCATAGACTCTTATTACTTTGAC 50 469-446
23SC TAAGCTGACTAATACTAATTACCC 50 92-115
5SCB biotin-GAGAGTAGGTTATTGCCAGGG 50 243-263
23SN2 ACCATAGACTCTTATTACTTTGACCA 50 469-444
B.burgdorfei sensu lato (S1) a-CTTTGACCATATTTTTATCTTCCA 800 453-430
B. burgdorferi sensu stricto (Ss) a-AACACCAATATTTAAAAAACATAA 20 322-299
B. garinii (Ga) a-AACATGAACATCTAAAAACATAAA 10 322-298
B. afzelii (Af) a-AACATTTAAAAAATAAATTCAAGG 200 305-278
B. valaisiana (Vs) a-CATTAAAAAAATATAAAAAATAAATTTAAGG 10 303-278