Skip to main content

Table 2 Primers used in the nested and real-time squirrelpox virus PCRs.

From: Detection of squirrel poxvirus by nested and real-time PCR from red (Sciurus vulgaris) and grey (Sciurus carolinensis) squirrels

Stage Primer orientation Sequence (5' - 3')
1st round nested PCR SqP1 - forward
SqP2 - reverse
GCGGCCGCGCTGACCGCCATCG
CCAGCACGACTTCTTCCTGGAG
2nd round nested PCR SqP3 - forward
SqP4 - reverse
CGCTCGCGTGTCCTACAGCCTG
GCAGTCCGCAGCGCGCGCAGAT
Real-time PCR primers SP7 - forward
SP8 - reverse
GGGCGATCGTGCCGCTCAG
CGCCTCGAGGTCCGGCTC