Skip to main content

Table 3 Primers used in this study for MLVA and SNR analyses

From: SNR analysis: molecular investigation of an anthrax epidemic

  LOCUS PRIMER SEQUENCE (5' to 3') CONCENTRATION μM
MLVA 25    
  CG3 F:CY5.5-TGTCGTTTTACTTCTCTCTCCAATAC
R:AGTCATTGTTCTGTATAAAGGGCAT
0.30
  bams44 F: CY5.5-GCACTTGAATATTTGGCGGTAT
R: GCGAATTAATTGCTCCTCAAAT
0.30
  bams3 F: CY5.5-GCAGCAACAGAAAACTTCTCTCCAATAACA
R:TCCTCCCTGAGAACTGCTATCACCTTTAAC
0.30
Multiplex A vrrB2 F: D2-CACAGGCTATTCTTTATCAAACTCATC
R: CCCAAGGTGAAGATTGTTGTTGA
0.15
  bams5 F: D2-GCAGGAAGAACAAAAGAAACTAGAAGAGCA
R: ATTATTAGCAGGGGCCTCTCCTGCATTACC
0.30
  bams15 F: D2-GTATTTCCCCCAGATACAGTAATCC
R: GTGTACATGTTGATTCATGCTGTTT
0.60
  bams1 F: CY5-GTTGAGCATGAGAGGTACCTTGTCCTTTTT
R: AGTTCAAGCGCCAGAAGGTTATGAGTTATC
0.15
  vrrC1 F: CY5-GAAGCAAGAAAGTGATGTAGTGGAC
R: CATTTCCTCAAGTGCTACAGGTTC
0.30
  bams13 F: CY5.5-AATTGAGAAATTGCTGTACCAAACT
R: CTAGTGCATTTGACCCTAATCTTGT
0.30
  vrrB1 F: CY5--ATAGGTGGTTTTCCGCAAGTT
R: GATGAGTTTGATAAAGAATAGCCTGTG
0.10
Multiplex B bams28 F: CY5-CTCTGTTGTAACAAAATTTCCGTCT
R: TATTAAACCAGGCGTTACTTACAGC
0.15
  vrrC2 F: CY5-CCAGAAGAAGTGGAACCTGTAGCAC
R: GTCTTTCCATTAATCGCGCTCTATC
0.10
  bams53 F: D2-GAGGTGTGTTAGGTGGGCTTAC
R: CATATTTTCACCTTAATTTTGGAAG
0.60
  bams31 F: D2-GCTGTATTTATCGAGCTTCAAAATCT
R: GGAGTACTGTTTGTTGAATGTTGTTT
0.60
  vrrA F: CY5.5-CACAACTACCACCGATGGCACA
R: GCGCGTTTCGTTTGATTCATAC
0.06
  bams25 F: CY5.5-CCGAATACGTAAGAAATAAATCCAC
R: TGAAAGATCTTGAAAAACAAGCATT
0.15
Multiplex C bams21 F: CY5.5-TGTAGTGCCAGATTTGTCTTCTGTA
R: CAAATTTTGAGATGGGAGTTTTACT
0.30
  bams34 F: D2-TGTGCTAAATCATCTTGCTTGG
R: CAGCAAAATCAATCGAATCAAA
0.30
  bams24 F: CY5-CTTCTACTTCCGTACTTGAAATTGG
R: CGTCACGTACCATTTAATGTTGTTA
0.30
  bams51 F: CY5-ATTTCCTGAAGCAGGTTGTGTT
R: TGCATCTAACAATGCAGAACAA
0.60
  bams22 F: CY5-ATCAAAAATTCTTGGCAGACTGA
R: ACCGTTAATTCACGTTTAGCAGA
0.15
Multiplex D bams23 F: D2-CGGTCTGTCTCTATTATTCAGTGGT
R: CCTGTTGCTCCTAGTGATTTCTTAC
0.30
  bams30 F: CY5.5-AGCTAATCACCTACAACACCTGGTA
R: CAGAAAATATTGGACCTACCTTCC
0.30
  pXO1 F: CY5-CAATTTATTAACGATCAGATTAAGTTCA
R: TCTAGAATTAGTTGCTTCATAATGGC
0.15
  pXO2 F: CY5.5-TCATCCTCTTTTAAGTCTTGGGT
R: GTGTGATGAACTCCGACGACA
0.15
STR-MTD    
Singleplex A CL33 F: 6FAM-TGGGGTATATTCCCATCGAA
R:CCGCAGATACCAACCAACAT
0.2
Singleplex B CL12 F: 6FAM-AAGCCAGGTGCAAAAACAGT
R: TCTCACTGTGCCTCGCTAAA
0.2
Singleplex C CL1 F: 6FAM-TTCTCGGAGATGATTTTCGG
R:CTCCCATTTTACATCCCCCT
0.2
Singleplex D CL37 F: NED-CTCCGCAATTTTCAAACGAT
R: CCGCCGGCATAAAGATAGTA
0.2
KEN-MTD    
  CL33
HM1
F: PET GAAAACTTTGCAACCGACC
R: GTCGAACGTGTTCTAGCTACAG
0.2
Multiplex I CL10
HM6
F: 6FAM-TAAAAAGACAGAATTTTCAATTTTATCAACAAC
R: GTGGAAACTAATGTGAGTTATATATGTTAGTTAAG
0.2
  CL12
HM2
F: VIC-GCTATTCTCACTGTGCCTCG
R: GTTAAAACGAAGTAAAGAAAAGTGGG
0.2
  CL35
HM13
F: NED-GGATTGCTTAAGGTATATAATGGATTT
R: GTTGTGTTCCATATGTATCCCTCC
0.1