Skip to main content

Table 1 Sequences (5'-3') of forward and reverse primers used in real-time PCR

From: Temporal patterns of inflammatory gene expression in local tissues after banding or burdizzo castration in cattle

Gene Forward primer sequence Reverse primer sequence
IL-1α TTGGTGCACATGGCAAGTG GCACAGTCAAGGCTATTTTTCCA
IL-6 GCGCATGGTCGACAAAATCT TGTCTCCTTGCTGCTTTCACA
IL-8 TGGGCCACACTGTGAAAATTC CCTTCTGCACCCACTTTTCC
IL-10 CTTGTCGGAAATGATCCAGTTTT TCAGGCCCGTGGTTCTCA
IFN-γ TGGAGGACTTCAAAAAGCTGATT TTTATGGCTTTGCGCTGGAT
TNF-α TCTACCAGGGAGGAGTCTTCCA GTCCGGCAGGTTGATCTCA
β-actin CGCCATGGATGATGATATTGC AAGCGGCCTTGCACAT