Skip to main content

Table 1 List of the primers used for real time quantitative RT-PCR.

From: Gene expression profiling in equine polysaccharide storage myopathy revealed inflammation, glycogenesis inhibition, hypoxia and mitochondrial dysfunctions

Gene Primer name Primer sequence Length Salt Tm GC%
IL18 IL18_1Fwd TGCATTAGCTTGGTGGAAATG 21 61 42
  IL18_1Rev AGGTTCAAGCCTGCCAAAGT 20 61 50
CTSS CTSS_1Fwd ACAACGGCATCGATTCAGAC 20 61 50
  CTSS_1Rev GCCAAAGGGAAGTTCGGTAT 20 60 50
LUM LUM_1Fwd CCTGGAGGTCAATGAACTTGAA 22 61 45
  LUM_1Rev ACGCAAATGCTTGATCTTGG 20 61 45
CD44 CD44_1Fwd GATCCACCCCAACTCCATCT 20 61 55
  CD44_1Rev TGACCGAGGTGCAGTCTTCT 20 61 55
FN1 FN1_1Fwd CCCTGGTGTCACAGAGGCTA 20 61 60
  FN1_1Rev AGTTGGGGAGGCTCATCTGT 20 61 55
GSTO1 GSTO1_1Fwd TACCTCATCTGGCCCTGGTT 20 62 55
  GSTO1_1Rev ATGGCTTCCATCCAGAGCTT 20 61 55
VCAM1 VCAM1_1Fwd GCACTGCCATTGAGATGTGA 20 61 50
  VCAM1_1Rev TGCAATGTTGCTATGGCTCA 20 61 45
ITGB1 ITGB1_1Fwd TCTCCAGAAGGTGGCTTTGA 20 61 50
  ITGB1_1Rev TCCGTGGAAAATACCAGCAG 20 61 50
CXCR4 CXCR4_1Fwd GCAGCAGCAGGTAGCAAAGT 20 61 55
  CXCR4_1Rev CCACGTCATCCTCCGTGTAG 20 61 60
HIF1A HIF1A_1Fwd GGACTCGGATCATCTGACCA 20 61 55
  HIF1A_1Rev TATCCCCCTCTTTTGGCAAG 20 61 50
NFKBIB NFKBIB_1Fwd CGTCATCCACAAAGATGCAG 20 60 50
  NFKBIB_1Rev CTGGGCCTCAACAGCCTAGT 20 62 60
PLCG2 PLCG2_1Fwd CATCTTGTACGGCACCCAGT 20 61 55
  PLCG2_1Rev TTCAAGCCAGACAGCCACTT 20 61 50
ND3 ND3fwd CCACAACTAAACATCTATGCAGAAAAA 27 62 33
  ND3rev GGAGGCGTGCTGACCCTAT 19 62 63
SLC25a17 SLC25a17_1Fwd GCAATCTGGGTCAAAGGTCA 20 61 50
  SLC25a17_1Rev GCCCCTTGCAGCTTTAGTCT 20 61 55
SRI SRI_1Fwd ATTGCCGGAGGATACAAACC 20 61 50
  SRI_1Rev GCCATTCAGTACAGCCCAGA 20 61 55
ND5 ND5fwd GATGATGATACGGCCGAACAG 21 61 52
  ND5rev CCCGATGCGGTTATAAAGGA 20 58 50
PDE4D PDE4D_1Fwd AGCCTGCGAACTGTACGAAA 20 61 50
  PDE4D_1Rev ATGGATGGTTGGTTGCACAT 20 61 45
SLC25a15 SLC25a15_1Fwd TGAACTGAGCCGATCGTTTT 20 61 45
  SLC25a15_1Rev CAGAGGCAGATTCCACCAAC 20 61 55
VEGF VEGF_1Fwd TCTACCTCCACCATGCCAAG 20 61 55
  VEGF_1Rev GTCTCGATTGGACGGCAGTA 20 61 55
PRKCA PRKCA_1Fwd GACTTCATGGGCTCCCTTTC 20 61 55
  PRKCA_1Rev TCTTCGTCCCCTTCTGGAAT 20 61 50
SLC2A2 SLC2A2_1Fwd GCCATCGGTACTCTTCACCA 20 61 55
  SLC2A2_1Rev TGTGCCACAGCTTCTGATTG 20 61 50