Skip to main content

Table 4 Primers used for genotyping of SNPs

From: Investigation of SNPs in the porcine desmoglein 1 gene

Fragment Size Primer Nucleotide sequence (5'-3')
Exon 7-8 511 bp Exon7-8.F AGGGGCAGATGGTATGTCAG
   Exon7-8.R CAACCTCCCTCATTTCCAGA
Exon 9 165 bp Exon9.F CCCCTAGATTATGAAGAGGTGGA
   Exon9.R TCTTTGAACCTGGACGGAAC
  1. All primers were designed in this study from the sequence: GenBank: DQ823081