Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes

Wiersma, Anje C; Leegwater, Peter AJ; van Oost, Bernard A; Ollier, William E; Dukes-McEwan, Joanna

doi:10.1186/1746-6148-3-28

BMC Veterinary Research

Table 2 Single Nucleotide Polymorphisms in the DCM candidate genes. For each SNP its origin, its primers and the PCR conditions, and its informativity are listed.

From: Canine candidate genes for dilated cardiomyopathy: annotation of and polymorphic markers for 14 genes

Gene	dbSNP access. no. ss4985...	SNP	Primers (5'-3') Forward; Reverse	Ta (°C)¹	Prod. size (bp)	Informativeness²
						PIC	#chr
*ACTC*	2973	5,452 G/A^a,3,4	gccctggattttgagaatgagat acgatcagcaataccagggtaca	62.0 ¹	1067	0.14	12
*CAV1*	2978	30,312 A/G ^b,5	tgagtgccttgcttgtgg gcatcattggaacttgttgg	62.0	565	0.28	24
	2979	30,088 G/A⁵	tgagtgccttgcttgtgg gcatcattggaacttgttgg	62.0	565	0.24	24
*CSPR3*	2980	31,216 A/G ⁶	ggaggccaggatgagaac gtttattgtactgaatgatggtcag	62.0	507	0.15	22
	2981	25,753 T/C ⁶	aatcatcctcccattgttcc cagaagtgctcatagtctttaccc	58.0	510	0.37	24
	2982	25,446 A/G ⁶	aatcatcctcccattgttcc cagaagtgctcatagtctttaccc	58.0	510	0.24	24
	2983	28,779 A/G ⁶	atggacctttgtatctccag tctgtaggtttcattcattgg	58.0	455	0.19	24
	2984	28,742 C/A ⁶	atggacctttgtatctccag tctgtaggtttcattcattgg	58.0	455	0.19	24
	2985	28,737 G/A ⁶	atggacctttgtatctccag tctgtaggtttcattcattgg	58.0	455	0.19	24
	2986	28,642 T/A ⁶	atggacctttgtatctccag tctgtaggtttcattcattgg	58.0	455	0.19	24
*DES*	2989	15,228 C/T ⁷	cgtcacaacccccacaag gctgggtgccatgaggtc	67.0	530	0.30	8
	2990	15,224 C/G ⁷	cgtcacaacccccacaag gctgggtgccatgaggtc	67.0	530	0.19	8
	2991	15,166 G/A ⁷	cgtcacaacccccacaag gctgggtgccatgaggtc	67.0	530	0.19	8
	2992	15,006 C/T ⁷	cgtcacaacccccacaag gctgggtgccatgaggtc	67.0	530	0.19	8
	2993	19,903 T/C ⁷	agggcagagggagaccag gacctaatggtgggctttacc	66.0	575	0.30	8
	2975	19,196 C/T ^c,7,8	ttgcttgaccactaccagga⁹ agatgttcttagccgcgatg¹⁰	57.0 ¹	402	0.35	12
	2976	19,105 G/A ^7,8	ttgcttgaccactaccagga⁹ agatgttcttagccgcgatg¹⁰	57.0 ¹	402	0.30	12
*LDB3*	2987	14,090 C/T ¹¹	tgttaatcacctctgcggatagt ggctccctacacgttgatg	58.0	540	0.33	24
	2988	25,205 T/C ^12,d	gcctcctccatcctgacc cctcccagtaccctgtaggc	66.0	566	0.19	24
	s2974	25,452 A/G ¹²	gcctcctccatcctgacc cctcccagtaccctgtaggc	66.0	566	0.38	24
*PLN*	2994	51,818 A/G ¹³	tggtttgccttcatacactacaac tgtcttcatctgtgggattttg	64.0	573	0.21	14
*SGCD*	2995	30,703 G/C ¹⁴	ccttcagacccccatctagg ccacctgacataatcccactttag	66.0	521	0.36	8
	2996	151,312 A/G ¹⁴	ggaggtagcaaagtatagtgctc atgttcatgccaacaagc	62.0	558	0.30	8
	2997	29,656 C/G ¹⁴	ttccagccaactgagaagc cactgtcatttccatgtcaacc	58.0	525	0.30	8
	2998	116,470 A/G ¹⁴	gcaatctcctcctccagacc tcatggcctcactctgatctc	58.0	529	0.38	8
*TCAP*	2999	28,606 C/T ^15,e	gctgcttcccttgaatgc cagacagtggcaggaatcg	64.0	588	0.28	24
	2977	29,957 T/C ^15,f	gtagagggtagcagatttcagg ctctgggcaaactacaaagc	69.0	555	0.26	16
	3000	30,330 A/G ^15,g	tgctttgtagtttgcccagag agccagccaccctgtttac	64.0	557	0.30	8
	3001	30,687 C/T ^15,h	tgctttgtagtttgcccagag agccagccaccctgtttac	64.0	557	0.30	8
*TNNT2*	3002	10,466 C/T ¹⁶	tgaccctcacttggggaac cgcagggctcttccagac	58.0	519	0.38	24
	3003	10,577 T/C ¹⁶	tgaccctcacttggggaac cgcagggctcttccagac	58.0	519	0.38	24
	3004	10,671 T/C ¹⁶	tgaccctcacttggggaac cgcagggctcttccagac	58.0	519	0.38	24
*VCL*	3005	177,743 G/A¹⁷	tgcaggccacagagatgc ggaatgagggcggagcag	62.0	491	0.30	8

¹ All PCR program were Touchdown (TD) at the listed Ta, accept for the ACTC SNP: 94°C 5 min, 35× (94°C 30 sec, 62°C 1 min, 72°C 1 min), 72°C 10 min, 20°C ∞; and for the DES SNPs 19,196 C/T and 19,105 G/A: 94°C 10 min, 35× (94°C 30 sec, 57°C 30 sec, 72°30 sec), 72°C 10 min, 20°∞; ² The informativeness of each SNP was described by its polymorphism information content (PIC), based on the number of genotyped chromosomes (#chr) listed; ³ SNP detected while sequencing available ACTC SNPs (166C/T and 38C/T of [Genbank: AF203019] and 289T/A of [Genbank: AF203020], these were in the dog genome, respectively, 4,871G/A, 5,000 G/A and 5,454 A/T in [Genbank: AAEX01013478)] [26]; ⁴ in genomic contig AAEX01013478; ⁵ AAEX01048546; ⁶ AAEX01017412; ⁷ AAEX01055032; ⁸ SNP detected while sequencing available DES SNPs (1,808C/T and 1,851G/C of [Genbank: BK005142], these were in the dog genome, respectively, 19,262 G/A and 19,218C/G in [Genbank: AAEX01055032]) [28]; ⁹ M13-tailed F-primer: 5'- GTTTTCCCAGTCACGAC---- 3'; ¹⁰ M13-tailed R-primer: 5'- CAGGAAACAGCTATGAC----3'; ¹¹ in genomic contig AAEX01016584; ¹² AAEX01016582; ¹³ AAEX01014037; ¹⁴ AAEX01016848; ¹⁵ AAEX01022011; ¹⁶ AAEX01013360; ¹⁷ AAEX01016404; ^a is identical to SNP BICF237J37997 (Broad, at [39]); ^b identical to BICFPJ1220038; ^c identical to BICFPJ152241; ^d identical to BICF231J18538; ^e identical to BICFG630J165218; ^f identical to BIFG630J165217; ^g identical to BICFG630J165215; ^h identical to BICFG630J165213.

Back to article page

ISSN: 1746-6148

Contact us

General enquiries: journalsubmissions@springernature.com