Skip to main content

Table 3 Primer sequences used for real time RT- PCR

From: Differential cytokine gene expression profiles in the three pathological forms of sheep paratuberculosis

Gene Accession number Primer Sequence 5'-3' Product size (bp)
IL-1α
GenBank: NM_174092
F: TTGGTGCACATGGCAAGTG
R: GCACAGTCAAGGCTATTTTTCC
72
IL-1β
GenBank: X56972
F: CCTTGGGTATCAGGGACAA
R: TGCGTATGGCTTTCTTTAGG
317
IL-3
GenBank: Z18897
F: ACCTCCTTCTGCTCCTGCTT
R: TATTCCCAAGTCCCCATCTT
193
IL-6
GenBank: X68723
F: TCCAGAACGAGTTTGAGG
R: CATCCGAATAGCTCTCAG
236
IL-8
GenBank: X78306
F: ATGAGTACAGAACTTCGA
R: TCATGGATCTTGCTTCTC
222
IL-10
GenBank: U11421
F: CTGTTGACCCAGTCTCTGCT
R: ACCGCCTTTGCTCTTGTTT
305
IL-12p40
GenBank: AF004024
F: TCAGACCAGAGCAGTGAGGT
R: GCAGGTGAAGTGTCCAGAAT
243
IL-18
GenBank: AJ401033
F: GAGCACAGGCATAAAGATGG
R: TGAACAGTCAGAATCAGGCATA
241
IFNγq
GenBank: X52640
F: CTAAGGGTGGGCCTCTTTTC
R: CATCCACCGGAATTTGAATC
55
TNFα
GenBank: X56756
F: GAATACCTGGACTATGCCGA
R: CCTCACTTCCCTACATCCCT
238
TGFβ
GenBank: X76916
F: GAACTGCTGTGTTCGTCAGC
R: GGTTGTGCTGGTTGTACAGG
169
GM-CSF
GenBank: X53561
F: GATGGATGAAACAGTAGAAGTCG
R: CAGCAGTCAAAGGGAATGAT
261
TRAF1
GenBank: XM_589090
F: AGCAGAGGGTGTTGGAGTTG
R: CTGGGGAGAAGAGGCTGAC
186
GAPDH
GenBank: AF030943
F: GGTGATGCTGGTGCTGAGTA
R: TCATAAGTCCCTCCACGATG
265
SDHA
GenBank: NM_174178
F: ACCTGATGCTTTGTGCTCTGC
R: CCTGGATGGGCTTGGAGTAA
126