Skip to main content

Advertisement

Table 3 Primer sequences used for real time RT- PCR

From: Differential cytokine gene expression profiles in the three pathological forms of sheep paratuberculosis

Gene Accession number Primer Sequence 5'-3' Product size (bp)
IL-1α GenBank: NM_174092 F: TTGGTGCACATGGCAAGTG R: GCACAGTCAAGGCTATTTTTCC 72
IL-1β GenBank: X56972 F: CCTTGGGTATCAGGGACAA R: TGCGTATGGCTTTCTTTAGG 317
IL-3 GenBank: Z18897 F: ACCTCCTTCTGCTCCTGCTT R: TATTCCCAAGTCCCCATCTT 193
IL-6 GenBank: X68723 F: TCCAGAACGAGTTTGAGG R: CATCCGAATAGCTCTCAG 236
IL-8 GenBank: X78306 F: ATGAGTACAGAACTTCGA R: TCATGGATCTTGCTTCTC 222
IL-10 GenBank: U11421 F: CTGTTGACCCAGTCTCTGCT R: ACCGCCTTTGCTCTTGTTT 305
IL-12p40 GenBank: AF004024 F: TCAGACCAGAGCAGTGAGGT R: GCAGGTGAAGTGTCCAGAAT 243
IL-18 GenBank: AJ401033 F: GAGCACAGGCATAAAGATGG R: TGAACAGTCAGAATCAGGCATA 241
IFNγq GenBank: X52640 F: CTAAGGGTGGGCCTCTTTTC R: CATCCACCGGAATTTGAATC 55
TNFα GenBank: X56756 F: GAATACCTGGACTATGCCGA R: CCTCACTTCCCTACATCCCT 238
TGFβ GenBank: X76916 F: GAACTGCTGTGTTCGTCAGC R: GGTTGTGCTGGTTGTACAGG 169
GM-CSF GenBank: X53561 F: GATGGATGAAACAGTAGAAGTCG R: CAGCAGTCAAAGGGAATGAT 261
TRAF1 GenBank: XM_589090 F: AGCAGAGGGTGTTGGAGTTG R: CTGGGGAGAAGAGGCTGAC 186
GAPDH GenBank: AF030943 F: GGTGATGCTGGTGCTGAGTA R: TCATAAGTCCCTCCACGATG 265
SDHA GenBank: NM_174178 F: ACCTGATGCTTTGTGCTCTGC R: CCTGGATGGGCTTGGAGTAA 126