Skip to main content

Table 1 Primers used in this study

From: The molecular epidemiology of Foot-and-Mouth Disease virus serotypes A and O from 1998 to 2004 in Turkey

Sense/Antisense Designation Sequence (5' to 3') Published by
Sense O-1C244F GCAGCAAAACACATGTCAAACACCTT [26]
Sense O-1C272F TBGCRGGNCTYGCCCAGTACTAC [26]
Sense O-1C283F GCCCAGTACTACACACAGTACAG [26]
Antisense NK61 GACATGTCCTCCTGCATCTG [26]
Sense SV1 GCGCCACACCGCGTGTTGG [27]
Antisense P1 GAAGGGCCCAGGGTTGGACTC [27]
Sense P498¶ AATTACACATGGCAAGGCCGACGG [28]
Antisense P617 rc CCCGAGTGGCTTTGATGG [28]
Sense A1 ACCAATGTACAGGGATGGGT This study
Antisense A2 TTGCACCGTAGTTAAAGGAA This study
Sense B1 CTGAGAGAGCTGCACACTGC This study
Antisense B2 GTACTTGCTCGTCCCGTTGT This study