Skip to main content

Table 2 Primers, and gene accession number, annealing temperature, and product size for quantitative real-time PCR analysis

From: Characterization of ovine hepatic gene expression profiles in response to Escherichia coli lipopolysaccharide using a bovine cDNA microarray

Gene Forward & Reverse primer Accession no (°C) (bp)
GAPDH CCTGGAGAAACCTGCCAAGT
GCCAAATTCATTGTCGTACCA
TC186924 58 226
RPLPO CAACCCTGAAGTGCTTGACAT
AGGCAGATGGATCAGCCA
TC204704 62 220
CD14 TGAACATTGCCCAAGCACAC
GCCGAGACTGGGATTGTCAG
AY289201 58 101
C3 AGAAGCAGAAGCCTGATGGA
CCTCGCAGATGTCTTTAGCC
AF038130 60 150
IFNaR CGCATAAGAGCAGAAGAAGGA
TGTTCCAGGGGGAGAGATG
U65978 60 150
NRAMP1 TTGGCACAGCTATTGCATTC
TTCCGCAACCCGTAGTTATC
AF005380 60 121
SOD CGAGGCAAAGGGAGATACAG
TCTCCAAACTGATGGACGTG
M81129 60 90
MCP-1 GGGTGCTCATTCAGACCATT
CATGGGAACTCAAGGAGGAA
L32659 60 126
IGFBP3 CAGAGCACAGACACCCAGAA
TGCCCGTACTTATCCACACA
AF305199 58 233