Skip to main content

Table 2 Primers used in this study

From: Evaluation of tandem repeats for MLVA typing of Streptococcus uberis isolated from bovine mastitis

VNTR Primer sequence 5'-3' Location in 0140J strain genome
01–02 TGCAGCACAAATGGAAACTGC 26778–26798
  AGCTACAGGTGCAGGTGTTGC 27001–27021
03 CAGAATTAAAATATCCTTGTTTTTAC 37728–37753
  ATTCTTCTTCATAGTCATATAGTGGT 37942–37967
04 TGAAACTGCAACACGTACAGG 73293–73313
  ACGTTTGGAGTTGCTTCGATG 73709–73729
05 CGCAGAAAATCCTCAAGGAGC 78991–79011
  ACAGCATCACCAACACCCATG 79290–79310
06–07 CATATTACCTCTTATTCCTCTT 167562–167583
  TCAATAATATCAACAATCTCA 168054–168074
08 TTTGGATGCTTTCTTGGTTGG 242005–242025
  TTGCAGAGATTCGCCAACCTG 242325–242345
09 CTTTTAGCATAATTTTACCTTTTA 281297–281320
  ATAAGATCAATATGAAGTGTATCTA 281591–281615
10 CGAACATGGTTATATCGTCCCAG 423092–423114
  TCGGCAACAATGGCCATATCG 423980–424000
11–12 GTTTATTATCTTTATGAGTATGCTT 591027–591051
  TATCTATAAAATGCAAACGATTTA 591969–591992
13 ATGAACCGACAGCTAGTCTGG 654229–654249
  CATATGGTCGTACGGTCCCTG 654572–654592
14 CAAGCCTTGAAATTCATCTCC 902092–902112
  GCAAGGTTTTTCCTCGTTGA 902638–902657
15 AATATAGGAATTAATTTCAGTTCTTGAC 991780–991807
  TAAGTTTACCCTAGAAGAGAATACAGTT 992388–992415
16–17 ACCATTAGAGATGGTTACTTCTTTAC 1066796–1066821
  GTCTGAACGGACTTAATGGTATT 1067309–1067331
18 GAAACAAAGTTTCCATCTTTAT 1136358–1136379
  AAGATGAAGTTTATTATGGATTCTC 1137131–1137155
19 CCTCCACCTGATGGACCAACG 1146876–1146896
  CAGGTTGTCGAAGCAACTGTC 1147205–1147225
20 AAAAGAACTTTATGAATGGAAAAC 1209150–1209173
  ATGGTATCTAATAAGGTAAGACCAC 1210065–1210089
21 CAGTTGTACTTGTGGCTTGAC 1240077–1240097
  TTGCCCTTCGTTGGTTCGCTG 1240581–1240601
22 CCCCTAAAATCGCAGCAATA 1345744–1345763
  TTTGACCAATTATGGTCTATACGC 1345908–1345931
23 TTTACCTTCAGTTTCTTTAATC 1494658–1494679
  TAAAGATTTAGGTACTCAAAAAG 1494840–1494862
24 ACTTCCGAATTGTCATCGTTCG 1496796–1496817
  TGCTGACAGTAATGAACCAGC 1497170–1497190
25 GGTGTTTATTTCATATTGGTCAGC 1813638–1813661
  GAAGTTCAAAGTTGGTTCAAATGTT 1813932–1813956