Skip to main content

Table 2 Sequence of oligonucleotide probes covalently linked to the membrane.

From: Molecular diagnosis of Theileria and Babesiaspecies infecting cattle in Northern Spain using reverse line blot macroarrays

Probe Sequence (5'-3') Tm (°C) Reference
catchall TAATGGTTAATAGGA(A/G)C(A/G)GTTG 54.7a [17]
Theileria spp. GTTGAATTTCTGCT(A/G)CAT(C/T)GC 55.9a [19]
Babesia spp. CCT(G/T)GGTAATGGTTAATAGGAA 55.6a [20]
T. annulata CCTCTGGGGTCTGTGCA 57.6 [17]
T. buffeli GGCTTATTTCGG(A/T)TTGATTTT 52.0a [9]
B. bigemina CGTTTTTTCCCTTTTGTTGG 53.2 [9]
B. bovis CAGGTTTCGCCTGTATAATTGAG 58.9 [9]
B. divergens GTTAATATTGACTAATGTCGAG 52.8 [9]
B. major TCCGACTTTGGTTGGTGT 53.7 [17]
  1. a Tm for degenerate oligonucleotides are approximate values